Incidental Mutation 'R7655:Ghdc'
ID591149
Institutional Source Beutler Lab
Gene Symbol Ghdc
Ensembl Gene ENSMUSG00000017747
Gene NameGH3 domain containing
SynonymsD11Lgp1e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100766032-100770957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100769667 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 127 (A127T)
Ref Sequence ENSEMBL: ENSMUSP00000017891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017891] [ENSMUST00000139341]
Predicted Effect probably benign
Transcript: ENSMUST00000017891
AA Change: A127T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000017891
Gene: ENSMUSG00000017747
AA Change: A127T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Pfam:GH3 177 519 1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139341
SMART Domains Protein: ENSMUSP00000114260
Gene: ENSMUSG00000017747

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Ghdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1489:Ghdc UTSW 11 100768257 missense probably benign 0.39
R1568:Ghdc UTSW 11 100768505 missense probably benign 0.03
R1945:Ghdc UTSW 11 100769205 missense probably benign 0.10
R1999:Ghdc UTSW 11 100769192 missense probably benign 0.04
R2150:Ghdc UTSW 11 100769192 missense probably benign 0.04
R4779:Ghdc UTSW 11 100770103 missense possibly damaging 0.93
R4807:Ghdc UTSW 11 100770225 missense probably damaging 1.00
R4910:Ghdc UTSW 11 100766988 missense probably benign 0.26
R4952:Ghdc UTSW 11 100769151 missense probably damaging 1.00
R5001:Ghdc UTSW 11 100766834 missense probably damaging 1.00
R5220:Ghdc UTSW 11 100769717 missense probably damaging 0.98
R5422:Ghdc UTSW 11 100769194 missense probably benign 0.03
R5926:Ghdc UTSW 11 100768237 missense possibly damaging 0.78
R6165:Ghdc UTSW 11 100769102 missense possibly damaging 0.70
R7076:Ghdc UTSW 11 100769714 missense possibly damaging 0.75
R7299:Ghdc UTSW 11 100768116 missense possibly damaging 0.47
R7314:Ghdc UTSW 11 100769102 missense probably damaging 0.99
R7656:Ghdc UTSW 11 100769667 missense probably benign 0.04
Z1176:Ghdc UTSW 11 100769417 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACAGGCAGTACTTCCTGG -3'
(R):5'- ACCTGACACCTATTAGGATGGG -3'

Sequencing Primer
(F):5'- AGTACTTCCTGGAGCCAGC -3'
(R):5'- GAACCTTCCGGAATCATC -3'
Posted On2019-11-12