Incidental Mutation 'R7655:Ghdc'
ID 591149
Institutional Source Beutler Lab
Gene Symbol Ghdc
Ensembl Gene ENSMUSG00000017747
Gene Name GH3 domain containing
Synonyms D11Lgp1e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock # R7655 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 100766032-100770957 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 100769667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 127 (A127T)
Ref Sequence ENSEMBL: ENSMUSP00000017891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017891] [ENSMUST00000139341]
AlphaFold Q99J23
Predicted Effect probably benign
Transcript: ENSMUST00000017891
AA Change: A127T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000017891
Gene: ENSMUSG00000017747
AA Change: A127T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Pfam:GH3 177 519 1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139341
SMART Domains Protein: ENSMUSP00000114260
Gene: ENSMUSG00000017747

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Ghdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1489:Ghdc UTSW 11 100768257 missense probably benign 0.39
R1568:Ghdc UTSW 11 100768505 missense probably benign 0.03
R1945:Ghdc UTSW 11 100769205 missense probably benign 0.10
R1999:Ghdc UTSW 11 100769192 missense probably benign 0.04
R2150:Ghdc UTSW 11 100769192 missense probably benign 0.04
R4779:Ghdc UTSW 11 100770103 missense possibly damaging 0.93
R4807:Ghdc UTSW 11 100770225 missense probably damaging 1.00
R4910:Ghdc UTSW 11 100766988 missense probably benign 0.26
R4952:Ghdc UTSW 11 100769151 missense probably damaging 1.00
R5001:Ghdc UTSW 11 100766834 missense probably damaging 1.00
R5220:Ghdc UTSW 11 100769717 missense probably damaging 0.98
R5422:Ghdc UTSW 11 100769194 missense probably benign 0.03
R5926:Ghdc UTSW 11 100768237 missense possibly damaging 0.78
R6165:Ghdc UTSW 11 100769102 missense possibly damaging 0.70
R7076:Ghdc UTSW 11 100769714 missense possibly damaging 0.75
R7299:Ghdc UTSW 11 100768116 missense possibly damaging 0.47
R7314:Ghdc UTSW 11 100769102 missense probably damaging 0.99
R7656:Ghdc UTSW 11 100769667 missense probably benign 0.04
R9419:Ghdc UTSW 11 100770255 missense probably damaging 0.96
R9556:Ghdc UTSW 11 100768035 missense possibly damaging 0.90
R9684:Ghdc UTSW 11 100770265 missense probably benign 0.02
R9710:Ghdc UTSW 11 100768037 missense probably benign 0.00
Z1176:Ghdc UTSW 11 100769417 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACAGGCAGTACTTCCTGG -3'
(R):5'- ACCTGACACCTATTAGGATGGG -3'

Sequencing Primer
(F):5'- AGTACTTCCTGGAGCCAGC -3'
(R):5'- GAACCTTCCGGAATCATC -3'
Posted On 2019-11-12