Incidental Mutation 'R7655:Smoc1'
ID591151
Institutional Source Beutler Lab
Gene Symbol Smoc1
Ensembl Gene ENSMUSG00000021136
Gene NameSPARC related modular calcium binding 1
Synonyms2600002F22Rik, SPARC-related protein, SRG
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location81026808-81186414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81105908 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 91 (Q91L)
Ref Sequence ENSEMBL: ENSMUSP00000105976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021564] [ENSMUST00000110347] [ENSMUST00000129362]
Predicted Effect probably damaging
Transcript: ENSMUST00000021564
AA Change: Q91L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021564
Gene: ENSMUSG00000021136
AA Change: Q91L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 247 295 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 311 423 1.6e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110347
AA Change: Q91L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105976
Gene: ENSMUSG00000021136
AA Change: Q91L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 258 306 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 323 434 2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129362
AA Change: Q91L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122858
Gene: ENSMUSG00000021136
AA Change: Q91L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
KAZAL 41 86 6.91e-8 SMART
TY 114 161 8.41e-12 SMART
TY 247 295 1.79e-15 SMART
Pfam:SPARC_Ca_bdg 311 423 1.5e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain secreted protein that may have a critical role in ocular and limb development. Mutations in this gene are associated with microphthalmia and limb anomalies. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a transposon-induced allele exhibit ocular and limb defects. Mice homozygous for a knock-out allele exhibit neonatal lethality, osseous syndactyly, decreased body size, and iris and retina coloboma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Smoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Smoc1 APN 12 81152751 nonsense probably null
R1291:Smoc1 UTSW 12 81179591 missense probably damaging 0.97
R1902:Smoc1 UTSW 12 81104671 missense probably benign 0.32
R2109:Smoc1 UTSW 12 81150676 missense probably damaging 0.99
R2567:Smoc1 UTSW 12 81167590 missense probably damaging 0.99
R3900:Smoc1 UTSW 12 81167513 missense probably damaging 0.98
R4663:Smoc1 UTSW 12 81167602 missense probably damaging 1.00
R4762:Smoc1 UTSW 12 81167651 missense probably damaging 1.00
R4767:Smoc1 UTSW 12 81104773 critical splice donor site probably null
R4836:Smoc1 UTSW 12 81179548 missense probably damaging 1.00
R5264:Smoc1 UTSW 12 81104700 missense probably damaging 0.99
R5839:Smoc1 UTSW 12 81167585 missense probably damaging 1.00
R5898:Smoc1 UTSW 12 81104757 nonsense probably null
R7359:Smoc1 UTSW 12 81150701 missense probably damaging 1.00
R7611:Smoc1 UTSW 12 81179670 missense probably damaging 1.00
R7656:Smoc1 UTSW 12 81105908 missense possibly damaging 0.95
R8175:Smoc1 UTSW 12 81167666 missense probably damaging 0.97
V8831:Smoc1 UTSW 12 81168255 missense probably damaging 1.00
Z1177:Smoc1 UTSW 12 81027150 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCTAAGCGTTAAGAGGAAGG -3'
(R):5'- AAATGACCCTGGTGCTCTCTG -3'

Sequencing Primer
(F):5'- AAGGTAGCTCCAGCAGGTGTC -3'
(R):5'- TGGTGCTCTCTGGACACC -3'
Posted On2019-11-12