Incidental Mutation 'R7655:Rpl3l'
ID591164
Institutional Source Beutler Lab
Gene Symbol Rpl3l
Ensembl Gene ENSMUSG00000002500
Gene Nameribosomal protein L3-like
Synonyms1110057H16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R7655 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location24727820-24736143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24730986 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 53 (I53T)
Ref Sequence ENSEMBL: ENSMUSP00000138489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045186] [ENSMUST00000170239] [ENSMUST00000183214]
Predicted Effect probably benign
Transcript: ENSMUST00000045186
SMART Domains Protein: ENSMUSP00000038326
Gene: ENSMUSG00000002500

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 181 5.1e-72 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170239
AA Change: I105T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129325
Gene: ENSMUSG00000002500
AA Change: I105T

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 375 1.2e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183214
AA Change: I53T

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138489
Gene: ENSMUSG00000002500
AA Change: I53T

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 133 1.1e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares sequence similarity with ribosomal protein L3. The protein belongs to the L3P family of ribosomal proteins. Unlike the ubiquitous expression of ribosomal protein genes, this gene has a tissue-specific pattern of expression, with the highest levels of expression in skeletal muscle and heart. It is not currently known whether the encoded protein is a functional ribosomal protein or whether it has evolved a function that is independent of the ribosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col14a1 A G 15: 55,362,450 I170V unknown Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Rpl3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Rpl3l APN 17 24735471 missense probably damaging 0.96
IGL01364:Rpl3l APN 17 24732430 missense probably benign 0.07
IGL02009:Rpl3l APN 17 24732433 missense probably damaging 0.98
IGL02422:Rpl3l APN 17 24733988 nonsense probably null
IGL03309:Rpl3l APN 17 24736024 missense possibly damaging 0.64
PIT4468001:Rpl3l UTSW 17 24735483 missense probably benign 0.00
R1466:Rpl3l UTSW 17 24730871 missense probably benign
R1466:Rpl3l UTSW 17 24730871 missense probably benign
R1782:Rpl3l UTSW 17 24733456 missense probably benign 0.02
R2019:Rpl3l UTSW 17 24735516 unclassified probably benign
R2509:Rpl3l UTSW 17 24732386 missense possibly damaging 0.94
R3844:Rpl3l UTSW 17 24733942 missense probably benign 0.02
R4574:Rpl3l UTSW 17 24734010 missense possibly damaging 0.70
R4675:Rpl3l UTSW 17 24733610 missense probably benign 0.43
R5097:Rpl3l UTSW 17 24733461 missense probably damaging 1.00
R5106:Rpl3l UTSW 17 24732437 missense probably damaging 1.00
R5187:Rpl3l UTSW 17 24732455 missense possibly damaging 0.95
R6073:Rpl3l UTSW 17 24730887 missense probably benign
R6295:Rpl3l UTSW 17 24733992 missense probably benign
R7624:Rpl3l UTSW 17 24732427 missense probably benign
R7656:Rpl3l UTSW 17 24730986 missense probably benign 0.37
R7834:Rpl3l UTSW 17 24733463 missense possibly damaging 0.58
R7917:Rpl3l UTSW 17 24733463 missense possibly damaging 0.58
Z1177:Rpl3l UTSW 17 24728398 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCCATTGGCTGAGAAGTTTC -3'
(R):5'- ATCTTGAATCATCTCACCAGCC -3'

Sequencing Primer
(F):5'- GGCTGAGAAGTTTCCTCTCAAATC -3'
(R):5'- GCCAACCCTGAAGATGTACATATCTG -3'
Posted On2019-11-12