Incidental Mutation 'R7656:Fsip2'
ID 591179
Institutional Source Beutler Lab
Gene Symbol Fsip2
Ensembl Gene ENSMUSG00000075249
Gene Name fibrous sheath-interacting protein 2
Synonyms OTTMUSG00000013335
MMRRC Submission 045732-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.123) question?
Stock # R7656 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 82773978-82839281 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 82807886 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1402 (K1402E)
Ref Sequence ENSEMBL: ENSMUSP00000120314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143764]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000132967
SMART Domains Protein: ENSMUSP00000122350
Gene: ENSMUSG00000075249

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
low complexity region 953 962 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143764
AA Change: K1402E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120314
Gene: ENSMUSG00000075249
AA Change: K1402E

DomainStartEndE-ValueType
coiled coil region 271 297 N/A INTRINSIC
low complexity region 544 561 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1115 1120 N/A INTRINSIC
low complexity region 1531 1545 N/A INTRINSIC
low complexity region 2044 2057 N/A INTRINSIC
low complexity region 2507 2523 N/A INTRINSIC
low complexity region 2564 2575 N/A INTRINSIC
low complexity region 2866 2877 N/A INTRINSIC
low complexity region 2896 2915 N/A INTRINSIC
low complexity region 3220 3231 N/A INTRINSIC
low complexity region 3438 3447 N/A INTRINSIC
Pfam:FSIP2 4045 4408 3.5e-42 PFAM
Pfam:FSIP2 4375 4613 7.7e-26 PFAM
Pfam:FSIP2 4622 4932 4.3e-17 PFAM
Pfam:FSIP2 4903 5454 7e-27 PFAM
low complexity region 5507 5522 N/A INTRINSIC
low complexity region 5769 5780 N/A INTRINSIC
low complexity region 5834 5846 N/A INTRINSIC
low complexity region 5851 5867 N/A INTRINSIC
Pfam:FSIP2 5998 6867 N/A PFAM
low complexity region 6977 6990 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the sperm fibrous sheath. Genes encoding most of the fibrous-sheath associated proteins genes are transcribed only during the postmeiotic period of spermatogenesis. The protein encoded by this gene is specific to spermatogenic cells. Copy number variation in this gene may be associated with testicular germ cell tumors. Pseudogenes associated with this gene are reported on chromosomes 2 and X. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abitram A G 4: 56,804,218 (GRCm39) I78V probably benign Het
Acot2 A G 12: 84,039,691 (GRCm39) Y400C probably benign Het
Agbl1 A G 7: 76,059,080 (GRCm39) M237V Het
Atrnl1 C A 19: 57,599,811 (GRCm39) S9* probably null Het
BC031181 A T 18: 75,142,406 (GRCm39) K71* probably null Het
Bmal2 A G 6: 146,707,940 (GRCm39) T21A probably benign Het
Brpf1 A T 6: 113,291,835 (GRCm39) M294L probably benign Het
Camk2g T G 14: 20,789,410 (GRCm39) D382A possibly damaging Het
Ccdc33 T A 9: 58,025,748 (GRCm39) R94W probably damaging Het
Cd244a T A 1: 171,404,823 (GRCm39) L225Q probably damaging Het
Chsy1 G T 7: 65,820,778 (GRCm39) V338F probably damaging Het
Col14a1 A G 15: 55,225,846 (GRCm39) I170V unknown Het
Col6a2 G T 10: 76,443,590 (GRCm39) Q492K probably benign Het
Dnah12 G T 14: 26,581,273 (GRCm39) V3168L probably benign Het
Dnah7a T C 1: 53,535,164 (GRCm39) S2699G possibly damaging Het
Efhc1 A G 1: 21,031,281 (GRCm39) probably null Het
Ghdc C T 11: 100,660,493 (GRCm39) A127T probably benign Het
Glp1r T C 17: 31,149,572 (GRCm39) probably null Het
Gm19410 A T 8: 36,276,253 (GRCm39) M1637L probably benign Het
Grm5 T G 7: 87,779,459 (GRCm39) D998E probably benign Het
Krtcap3 A G 5: 31,409,904 (GRCm39) T157A probably damaging Het
Ltf A T 9: 110,853,462 (GRCm39) K18* probably null Het
Luc7l2 A G 6: 38,580,399 (GRCm39) R333G unknown Het
Mdc1 T G 17: 36,161,773 (GRCm39) S895R probably benign Het
Mef2a G A 7: 66,945,142 (GRCm39) T80M probably damaging Het
Mitd1 T A 1: 37,924,356 (GRCm39) I65F probably benign Het
Mms19 A G 19: 41,933,011 (GRCm39) L1026P probably damaging Het
Mtbp G T 15: 55,472,922 (GRCm39) V629L unknown Het
Ncapd3 T A 9: 26,966,801 (GRCm39) I545N possibly damaging Het
Nin G A 12: 70,089,542 (GRCm39) T1291M Het
Or10z1 T A 1: 174,077,784 (GRCm39) K236N probably damaging Het
Or5b123 A T 19: 13,597,197 (GRCm39) I181F probably damaging Het
Orc3 G T 4: 34,587,032 (GRCm39) C352* probably null Het
Oxct2b G A 4: 123,011,550 (GRCm39) G490D probably benign Het
Pcdhb16 A T 18: 37,612,458 (GRCm39) T473S probably benign Het
Phkg2 G A 7: 127,182,074 (GRCm39) G365D probably damaging Het
Pira1 T C 7: 3,742,281 (GRCm39) E82G probably damaging Het
Plekhd1 A G 12: 80,768,934 (GRCm39) probably null Het
Ppp2r3d A T 9: 101,088,911 (GRCm39) F471I probably benign Het
Prl3d1 T C 13: 27,284,018 (GRCm39) C196R possibly damaging Het
Prmt1 A T 7: 44,633,552 (GRCm39) F14L probably benign Het
Prox1 A G 1: 189,894,418 (GRCm39) L9P probably damaging Het
Ptpn13 T A 5: 103,688,849 (GRCm39) F881I probably benign Het
Rab3ip A G 10: 116,750,044 (GRCm39) I363T probably benign Het
Rapgef3 T C 15: 97,659,090 (GRCm39) E134G probably damaging Het
Rapgef6 C T 11: 54,585,279 (GRCm39) P1559L probably benign Het
Rnf180 T C 13: 105,304,096 (GRCm39) K507E probably damaging Het
Rpl3l T C 17: 24,949,960 (GRCm39) I53T probably benign Het
Rtl1 T C 12: 109,557,442 (GRCm39) I1466V unknown Het
Saxo2 A G 7: 82,284,559 (GRCm39) Y100H probably damaging Het
Selenoh G T 2: 84,500,724 (GRCm39) R39S probably damaging Het
Sgsm2 A G 11: 74,756,323 (GRCm39) V342A probably damaging Het
Slc26a9 T A 1: 131,690,982 (GRCm39) F587I possibly damaging Het
Smoc1 A T 12: 81,152,682 (GRCm39) Q91L possibly damaging Het
Spag9 A C 11: 93,887,389 (GRCm39) H98P possibly damaging Het
Spata31e3 T G 13: 50,401,122 (GRCm39) K401N probably benign Het
T2 T A 17: 8,637,047 (GRCm39) C337* probably null Het
Tbc1d19 A G 5: 54,054,377 (GRCm39) Y455C probably damaging Het
Thbd A G 2: 148,249,340 (GRCm39) L176P probably damaging Het
Tmem116 A G 5: 121,590,252 (GRCm39) probably null Het
Tmem25 C T 9: 44,709,640 (GRCm39) V54I possibly damaging Het
Trpm4 C T 7: 44,971,233 (GRCm39) V378I probably benign Het
Trrap G T 5: 144,779,422 (GRCm39) W3129C probably damaging Het
Ttn A T 2: 76,558,660 (GRCm39) D29740E probably damaging Het
Vcan C T 13: 89,833,233 (GRCm39) C3073Y probably damaging Het
Xrra1 T A 7: 99,560,189 (GRCm39) D388E probably benign Het
Other mutations in Fsip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Fsip2 APN 2 82,820,730 (GRCm39) missense probably benign 0.18
IGL00557:Fsip2 APN 2 82,821,657 (GRCm39) missense possibly damaging 0.53
IGL01343:Fsip2 APN 2 82,830,163 (GRCm39) missense possibly damaging 0.53
IGL01387:Fsip2 APN 2 82,823,326 (GRCm39) missense possibly damaging 0.71
IGL01523:Fsip2 APN 2 82,807,863 (GRCm39) missense probably benign
IGL01554:Fsip2 APN 2 82,807,622 (GRCm39) missense possibly damaging 0.68
IGL01650:Fsip2 APN 2 82,821,430 (GRCm39) missense probably benign 0.33
IGL01809:Fsip2 APN 2 82,808,691 (GRCm39) missense possibly damaging 0.80
IGL01826:Fsip2 APN 2 82,812,983 (GRCm39) missense probably benign 0.18
IGL01830:Fsip2 APN 2 82,815,273 (GRCm39) missense probably benign
IGL01918:Fsip2 APN 2 82,822,482 (GRCm39) missense possibly damaging 0.71
IGL01932:Fsip2 APN 2 82,824,349 (GRCm39) missense possibly damaging 0.71
IGL01989:Fsip2 APN 2 82,824,211 (GRCm39) missense probably damaging 0.99
IGL02096:Fsip2 APN 2 82,822,204 (GRCm39) missense possibly damaging 0.85
IGL02153:Fsip2 APN 2 82,809,065 (GRCm39) missense probably benign
IGL02155:Fsip2 APN 2 82,828,696 (GRCm39) missense probably benign
IGL02219:Fsip2 APN 2 82,808,174 (GRCm39) missense probably benign 0.07
IGL02248:Fsip2 APN 2 82,813,116 (GRCm39) missense possibly damaging 0.73
IGL02316:Fsip2 APN 2 82,809,137 (GRCm39) missense probably benign
IGL02478:Fsip2 APN 2 82,814,736 (GRCm39) missense probably benign 0.00
IGL02504:Fsip2 APN 2 82,809,199 (GRCm39) missense possibly damaging 0.83
IGL02572:Fsip2 APN 2 82,822,347 (GRCm39) missense probably benign 0.32
IGL02625:Fsip2 APN 2 82,779,836 (GRCm39) missense probably benign 0.00
IGL02665:Fsip2 APN 2 82,823,407 (GRCm39) missense probably damaging 1.00
IGL02668:Fsip2 APN 2 82,828,662 (GRCm39) missense probably benign 0.06
IGL02676:Fsip2 APN 2 82,812,501 (GRCm39) missense possibly damaging 0.53
IGL02717:Fsip2 APN 2 82,781,370 (GRCm39) splice site probably benign
IGL02805:Fsip2 APN 2 82,823,839 (GRCm39) missense probably benign 0.01
IGL02943:Fsip2 APN 2 82,822,701 (GRCm39) missense probably benign 0.32
IGL02965:Fsip2 APN 2 82,813,398 (GRCm39) missense probably benign 0.33
IGL03001:Fsip2 APN 2 82,820,968 (GRCm39) intron probably benign
IGL03076:Fsip2 APN 2 82,812,482 (GRCm39) missense possibly damaging 0.96
IGL03229:Fsip2 APN 2 82,808,420 (GRCm39) missense possibly damaging 0.86
IGL03353:Fsip2 APN 2 82,807,737 (GRCm39) missense possibly damaging 0.85
IGL03401:Fsip2 APN 2 82,820,814 (GRCm39) missense probably benign
bubblegum UTSW 2 82,823,184 (GRCm39) missense probably benign 0.16
Dao UTSW 2 82,823,494 (GRCm39) missense probably damaging 0.97
engulf UTSW 2 82,815,120 (GRCm39) missense probably damaging 0.98
envelope UTSW 2 82,811,085 (GRCm39) missense probably benign 0.07
gladius UTSW 2 82,812,293 (GRCm39) missense possibly damaging 0.68
glove UTSW 2 82,808,738 (GRCm39) missense possibly damaging 0.85
Katana UTSW 2 82,819,860 (GRCm39) missense probably benign 0.07
scarf UTSW 2 82,817,235 (GRCm39) missense probably benign
Sock UTSW 2 82,828,524 (GRCm39) missense probably benign 0.00
swaddle UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
wrap UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
Wrapper UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
D4186:Fsip2 UTSW 2 82,818,756 (GRCm39) missense probably benign 0.32
FR4976:Fsip2 UTSW 2 82,814,709 (GRCm39) critical splice acceptor site probably benign
FR4976:Fsip2 UTSW 2 82,814,706 (GRCm39) critical splice acceptor site probably benign
PIT4382001:Fsip2 UTSW 2 82,821,196 (GRCm39) missense possibly damaging 0.86
R0017:Fsip2 UTSW 2 82,822,416 (GRCm39) missense probably damaging 0.98
R0017:Fsip2 UTSW 2 82,822,416 (GRCm39) missense probably damaging 0.98
R0021:Fsip2 UTSW 2 82,830,201 (GRCm39) splice site probably benign
R0054:Fsip2 UTSW 2 82,817,299 (GRCm39) missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82,817,299 (GRCm39) missense possibly damaging 0.85
R0054:Fsip2 UTSW 2 82,806,952 (GRCm39) missense probably damaging 0.96
R0104:Fsip2 UTSW 2 82,809,317 (GRCm39) missense possibly damaging 0.91
R0104:Fsip2 UTSW 2 82,809,317 (GRCm39) missense possibly damaging 0.91
R0127:Fsip2 UTSW 2 82,815,269 (GRCm39) missense probably benign 0.28
R0131:Fsip2 UTSW 2 82,821,465 (GRCm39) missense probably benign
R0149:Fsip2 UTSW 2 82,805,849 (GRCm39) missense possibly damaging 0.93
R0167:Fsip2 UTSW 2 82,811,151 (GRCm39) missense possibly damaging 0.53
R0190:Fsip2 UTSW 2 82,815,521 (GRCm39) missense possibly damaging 0.73
R0323:Fsip2 UTSW 2 82,816,240 (GRCm39) missense probably benign 0.33
R0358:Fsip2 UTSW 2 82,813,677 (GRCm39) missense possibly damaging 0.56
R0361:Fsip2 UTSW 2 82,805,849 (GRCm39) missense possibly damaging 0.93
R0369:Fsip2 UTSW 2 82,814,908 (GRCm39) missense probably benign 0.33
R0394:Fsip2 UTSW 2 82,821,419 (GRCm39) missense possibly damaging 0.70
R0532:Fsip2 UTSW 2 82,808,129 (GRCm39) missense probably benign 0.33
R0595:Fsip2 UTSW 2 82,777,296 (GRCm39) missense probably damaging 0.99
R0613:Fsip2 UTSW 2 82,824,139 (GRCm39) missense probably damaging 0.99
R0614:Fsip2 UTSW 2 82,807,877 (GRCm39) missense probably benign 0.15
R0619:Fsip2 UTSW 2 82,774,484 (GRCm39) missense probably damaging 1.00
R0626:Fsip2 UTSW 2 82,819,302 (GRCm39) missense probably benign 0.06
R0644:Fsip2 UTSW 2 82,807,241 (GRCm39) missense probably benign 0.02
R0661:Fsip2 UTSW 2 82,816,513 (GRCm39) missense possibly damaging 0.92
R0680:Fsip2 UTSW 2 82,821,703 (GRCm39) missense possibly damaging 0.73
R0688:Fsip2 UTSW 2 82,812,683 (GRCm39) missense probably benign 0.18
R0881:Fsip2 UTSW 2 82,816,617 (GRCm39) missense possibly damaging 0.52
R0919:Fsip2 UTSW 2 82,815,828 (GRCm39) missense possibly damaging 0.53
R0973:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0973:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0974:Fsip2 UTSW 2 82,807,436 (GRCm39) missense probably benign 0.05
R0976:Fsip2 UTSW 2 82,828,375 (GRCm39) missense possibly damaging 0.92
R1025:Fsip2 UTSW 2 82,819,780 (GRCm39) nonsense probably null
R1026:Fsip2 UTSW 2 82,818,805 (GRCm39) missense possibly damaging 0.52
R1140:Fsip2 UTSW 2 82,805,378 (GRCm39) missense probably damaging 0.99
R1170:Fsip2 UTSW 2 82,821,844 (GRCm39) missense possibly damaging 0.72
R1180:Fsip2 UTSW 2 82,805,570 (GRCm39) missense probably damaging 0.99
R1188:Fsip2 UTSW 2 82,805,361 (GRCm39) missense possibly damaging 0.96
R1226:Fsip2 UTSW 2 82,811,355 (GRCm39) missense probably damaging 0.96
R1248:Fsip2 UTSW 2 82,820,107 (GRCm39) missense possibly damaging 0.93
R1273:Fsip2 UTSW 2 82,819,752 (GRCm39) missense possibly damaging 0.92
R1323:Fsip2 UTSW 2 82,816,096 (GRCm39) missense probably damaging 1.00
R1323:Fsip2 UTSW 2 82,816,096 (GRCm39) missense probably damaging 1.00
R1356:Fsip2 UTSW 2 82,820,089 (GRCm39) missense probably benign 0.38
R1413:Fsip2 UTSW 2 82,818,762 (GRCm39) missense possibly damaging 0.93
R1430:Fsip2 UTSW 2 82,828,407 (GRCm39) missense possibly damaging 0.71
R1475:Fsip2 UTSW 2 82,817,539 (GRCm39) missense probably damaging 0.99
R1489:Fsip2 UTSW 2 82,810,155 (GRCm39) missense probably benign
R1520:Fsip2 UTSW 2 82,811,058 (GRCm39) missense possibly damaging 0.96
R1543:Fsip2 UTSW 2 82,811,931 (GRCm39) missense possibly damaging 0.91
R1581:Fsip2 UTSW 2 82,816,626 (GRCm39) missense probably damaging 0.98
R1590:Fsip2 UTSW 2 82,813,131 (GRCm39) missense probably benign 0.26
R1646:Fsip2 UTSW 2 82,808,861 (GRCm39) missense probably benign 0.07
R1678:Fsip2 UTSW 2 82,816,689 (GRCm39) missense probably benign
R1700:Fsip2 UTSW 2 82,822,081 (GRCm39) missense probably benign 0.33
R1717:Fsip2 UTSW 2 82,805,289 (GRCm39) missense possibly damaging 0.68
R1741:Fsip2 UTSW 2 82,820,256 (GRCm39) missense probably benign 0.32
R1760:Fsip2 UTSW 2 82,818,055 (GRCm39) missense possibly damaging 0.71
R1760:Fsip2 UTSW 2 82,815,240 (GRCm39) missense probably benign 0.07
R1760:Fsip2 UTSW 2 82,830,185 (GRCm39) missense possibly damaging 0.85
R1789:Fsip2 UTSW 2 82,807,906 (GRCm39) missense probably benign 0.00
R1850:Fsip2 UTSW 2 82,814,933 (GRCm39) missense possibly damaging 0.72
R1854:Fsip2 UTSW 2 82,823,601 (GRCm39) missense possibly damaging 0.84
R1888:Fsip2 UTSW 2 82,774,504 (GRCm39) missense probably benign 0.04
R1888:Fsip2 UTSW 2 82,774,504 (GRCm39) missense probably benign 0.04
R1905:Fsip2 UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
R1907:Fsip2 UTSW 2 82,813,772 (GRCm39) missense possibly damaging 0.93
R1920:Fsip2 UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
R1921:Fsip2 UTSW 2 82,817,164 (GRCm39) missense probably benign 0.04
R1921:Fsip2 UTSW 2 82,811,127 (GRCm39) nonsense probably null
R1931:Fsip2 UTSW 2 82,817,077 (GRCm39) missense probably damaging 0.99
R1934:Fsip2 UTSW 2 82,810,902 (GRCm39) missense possibly damaging 0.91
R1959:Fsip2 UTSW 2 82,821,894 (GRCm39) missense probably benign
R1965:Fsip2 UTSW 2 82,823,124 (GRCm39) missense possibly damaging 0.86
R1966:Fsip2 UTSW 2 82,823,124 (GRCm39) missense possibly damaging 0.86
R1983:Fsip2 UTSW 2 82,810,175 (GRCm39) missense probably benign
R1988:Fsip2 UTSW 2 82,806,861 (GRCm39) missense possibly damaging 0.56
R2016:Fsip2 UTSW 2 82,813,076 (GRCm39) missense possibly damaging 0.53
R2017:Fsip2 UTSW 2 82,813,076 (GRCm39) missense possibly damaging 0.53
R2026:Fsip2 UTSW 2 82,819,788 (GRCm39) missense possibly damaging 0.71
R2034:Fsip2 UTSW 2 82,819,838 (GRCm39) missense probably benign 0.43
R2037:Fsip2 UTSW 2 82,808,856 (GRCm39) missense probably damaging 0.99
R2070:Fsip2 UTSW 2 82,806,699 (GRCm39) missense probably damaging 0.98
R2072:Fsip2 UTSW 2 82,839,159 (GRCm39) missense possibly damaging 0.53
R2075:Fsip2 UTSW 2 82,818,923 (GRCm39) missense possibly damaging 0.85
R2143:Fsip2 UTSW 2 82,820,615 (GRCm39) missense possibly damaging 0.93
R2207:Fsip2 UTSW 2 82,807,823 (GRCm39) missense probably benign 0.02
R2256:Fsip2 UTSW 2 82,793,095 (GRCm39) missense probably benign 0.07
R2315:Fsip2 UTSW 2 82,805,437 (GRCm39) missense probably benign
R2344:Fsip2 UTSW 2 82,820,257 (GRCm39) missense possibly damaging 0.71
R2377:Fsip2 UTSW 2 82,806,593 (GRCm39) missense probably benign 0.29
R2403:Fsip2 UTSW 2 82,811,064 (GRCm39) missense possibly damaging 0.53
R2441:Fsip2 UTSW 2 82,815,685 (GRCm39) missense possibly damaging 0.53
R2504:Fsip2 UTSW 2 82,809,954 (GRCm39) missense possibly damaging 0.86
R2510:Fsip2 UTSW 2 82,816,782 (GRCm39) missense probably benign
R2511:Fsip2 UTSW 2 82,816,782 (GRCm39) missense probably benign
R2511:Fsip2 UTSW 2 82,782,001 (GRCm39) missense probably damaging 1.00
R2512:Fsip2 UTSW 2 82,808,511 (GRCm39) missense probably benign 0.04
R2568:Fsip2 UTSW 2 82,820,775 (GRCm39) missense probably benign 0.14
R2656:Fsip2 UTSW 2 82,809,389 (GRCm39) missense possibly damaging 0.83
R2883:Fsip2 UTSW 2 82,821,868 (GRCm39) missense possibly damaging 0.86
R3417:Fsip2 UTSW 2 82,816,854 (GRCm39) missense possibly damaging 0.51
R3431:Fsip2 UTSW 2 82,822,354 (GRCm39) missense possibly damaging 0.85
R3441:Fsip2 UTSW 2 82,817,071 (GRCm39) missense probably benign 0.00
R3605:Fsip2 UTSW 2 82,815,253 (GRCm39) missense probably benign 0.28
R3620:Fsip2 UTSW 2 82,810,602 (GRCm39) missense probably benign 0.00
R3621:Fsip2 UTSW 2 82,810,602 (GRCm39) missense probably benign 0.00
R3726:Fsip2 UTSW 2 82,819,311 (GRCm39) missense possibly damaging 0.84
R3755:Fsip2 UTSW 2 82,808,561 (GRCm39) missense probably benign 0.26
R3789:Fsip2 UTSW 2 82,813,058 (GRCm39) missense probably damaging 0.96
R3836:Fsip2 UTSW 2 82,781,290 (GRCm39) missense probably damaging 1.00
R3844:Fsip2 UTSW 2 82,819,950 (GRCm39) missense possibly damaging 0.52
R3846:Fsip2 UTSW 2 82,816,759 (GRCm39) missense possibly damaging 0.52
R3861:Fsip2 UTSW 2 82,815,120 (GRCm39) missense probably damaging 0.98
R3981:Fsip2 UTSW 2 82,789,006 (GRCm39) missense probably benign 0.08
R4014:Fsip2 UTSW 2 82,813,862 (GRCm39) missense probably benign
R4042:Fsip2 UTSW 2 82,813,896 (GRCm39) missense probably benign 0.02
R4075:Fsip2 UTSW 2 82,813,245 (GRCm39) missense probably benign 0.26
R4154:Fsip2 UTSW 2 82,817,413 (GRCm39) missense possibly damaging 0.71
R4210:Fsip2 UTSW 2 82,805,493 (GRCm39) missense probably damaging 0.99
R4211:Fsip2 UTSW 2 82,805,493 (GRCm39) missense probably damaging 0.99
R4327:Fsip2 UTSW 2 82,817,403 (GRCm39) missense probably benign 0.25
R4332:Fsip2 UTSW 2 82,808,201 (GRCm39) missense probably benign 0.00
R4440:Fsip2 UTSW 2 82,821,550 (GRCm39) missense possibly damaging 0.85
R4454:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4455:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4457:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4458:Fsip2 UTSW 2 82,821,120 (GRCm39) missense possibly damaging 0.70
R4540:Fsip2 UTSW 2 82,782,009 (GRCm39) missense probably benign
R4549:Fsip2 UTSW 2 82,819,972 (GRCm39) missense probably damaging 0.99
R4558:Fsip2 UTSW 2 82,815,297 (GRCm39) missense possibly damaging 0.73
R4573:Fsip2 UTSW 2 82,816,510 (GRCm39) missense possibly damaging 0.71
R4583:Fsip2 UTSW 2 82,809,017 (GRCm39) missense probably benign 0.33
R4618:Fsip2 UTSW 2 82,818,103 (GRCm39) missense probably benign
R4700:Fsip2 UTSW 2 82,817,373 (GRCm39) missense probably benign 0.32
R4716:Fsip2 UTSW 2 82,805,203 (GRCm39) missense probably damaging 0.96
R4739:Fsip2 UTSW 2 82,805,697 (GRCm39) missense possibly damaging 0.92
R4749:Fsip2 UTSW 2 82,819,629 (GRCm39) missense probably benign 0.06
R4791:Fsip2 UTSW 2 82,812,452 (GRCm39) missense possibly damaging 0.53
R4793:Fsip2 UTSW 2 82,818,044 (GRCm39) nonsense probably null
R4819:Fsip2 UTSW 2 82,818,786 (GRCm39) missense probably benign 0.06
R4832:Fsip2 UTSW 2 82,820,515 (GRCm39) missense possibly damaging 0.92
R4840:Fsip2 UTSW 2 82,815,815 (GRCm39) missense probably benign 0.26
R4840:Fsip2 UTSW 2 82,779,739 (GRCm39) missense probably benign 0.01
R4865:Fsip2 UTSW 2 82,821,295 (GRCm39) missense possibly damaging 0.86
R4876:Fsip2 UTSW 2 82,805,202 (GRCm39) missense possibly damaging 0.91
R4885:Fsip2 UTSW 2 82,818,438 (GRCm39) missense probably benign 0.02
R4911:Fsip2 UTSW 2 82,811,837 (GRCm39) missense possibly damaging 0.85
R4918:Fsip2 UTSW 2 82,824,114 (GRCm39) missense possibly damaging 0.51
R4936:Fsip2 UTSW 2 82,815,384 (GRCm39) missense probably benign 0.18
R4950:Fsip2 UTSW 2 82,807,758 (GRCm39) missense probably benign 0.03
R4950:Fsip2 UTSW 2 82,777,276 (GRCm39) missense probably damaging 0.97
R4959:Fsip2 UTSW 2 82,815,169 (GRCm39) missense probably benign 0.00
R4971:Fsip2 UTSW 2 82,816,222 (GRCm39) missense probably benign 0.38
R4973:Fsip2 UTSW 2 82,815,169 (GRCm39) missense probably benign 0.00
R4976:Fsip2 UTSW 2 82,818,535 (GRCm39) missense probably damaging 0.99
R5022:Fsip2 UTSW 2 82,809,773 (GRCm39) missense probably benign 0.33
R5027:Fsip2 UTSW 2 82,819,477 (GRCm39) missense possibly damaging 0.71
R5030:Fsip2 UTSW 2 82,818,836 (GRCm39) missense possibly damaging 0.85
R5048:Fsip2 UTSW 2 82,823,494 (GRCm39) missense probably damaging 0.97
R5096:Fsip2 UTSW 2 82,821,460 (GRCm39) missense probably benign 0.00
R5097:Fsip2 UTSW 2 82,822,329 (GRCm39) missense probably benign
R5119:Fsip2 UTSW 2 82,818,535 (GRCm39) missense probably damaging 0.99
R5138:Fsip2 UTSW 2 82,811,768 (GRCm39) missense probably benign 0.12
R5152:Fsip2 UTSW 2 82,808,916 (GRCm39) missense probably benign 0.43
R5174:Fsip2 UTSW 2 82,811,085 (GRCm39) missense probably benign 0.07
R5193:Fsip2 UTSW 2 82,813,338 (GRCm39) missense possibly damaging 0.53
R5245:Fsip2 UTSW 2 82,823,505 (GRCm39) missense probably benign 0.02
R5282:Fsip2 UTSW 2 82,808,925 (GRCm39) missense possibly damaging 0.61
R5323:Fsip2 UTSW 2 82,818,489 (GRCm39) missense possibly damaging 0.71
R5326:Fsip2 UTSW 2 82,812,207 (GRCm39) missense possibly damaging 0.84
R5378:Fsip2 UTSW 2 82,820,185 (GRCm39) missense possibly damaging 0.71
R5380:Fsip2 UTSW 2 82,805,742 (GRCm39) missense possibly damaging 0.91
R5396:Fsip2 UTSW 2 82,821,262 (GRCm39) missense probably benign 0.00
R5422:Fsip2 UTSW 2 82,812,572 (GRCm39) missense probably benign 0.00
R5481:Fsip2 UTSW 2 82,810,230 (GRCm39) missense probably benign 0.26
R5482:Fsip2 UTSW 2 82,815,654 (GRCm39) missense possibly damaging 0.80
R5513:Fsip2 UTSW 2 82,815,542 (GRCm39) missense possibly damaging 0.72
R5513:Fsip2 UTSW 2 82,781,256 (GRCm39) missense probably benign 0.07
R5513:Fsip2 UTSW 2 82,781,252 (GRCm39) missense probably damaging 1.00
R5536:Fsip2 UTSW 2 82,817,403 (GRCm39) missense probably benign 0.25
R5542:Fsip2 UTSW 2 82,812,207 (GRCm39) missense possibly damaging 0.84
R5553:Fsip2 UTSW 2 82,793,090 (GRCm39) missense probably benign
R5568:Fsip2 UTSW 2 82,816,908 (GRCm39) missense probably benign 0.25
R5581:Fsip2 UTSW 2 82,828,472 (GRCm39) missense possibly damaging 0.84
R5664:Fsip2 UTSW 2 82,818,439 (GRCm39) missense probably benign 0.05
R5672:Fsip2 UTSW 2 82,817,838 (GRCm39) nonsense probably null
R5712:Fsip2 UTSW 2 82,839,192 (GRCm39) missense possibly damaging 0.73
R5762:Fsip2 UTSW 2 82,808,260 (GRCm39) missense probably benign 0.33
R5772:Fsip2 UTSW 2 82,815,084 (GRCm39) missense probably benign
R5881:Fsip2 UTSW 2 82,814,785 (GRCm39) missense possibly damaging 0.72
R5919:Fsip2 UTSW 2 82,822,953 (GRCm39) missense possibly damaging 0.71
R5920:Fsip2 UTSW 2 82,818,852 (GRCm39) nonsense probably null
R5934:Fsip2 UTSW 2 82,817,092 (GRCm39) missense possibly damaging 0.86
R5938:Fsip2 UTSW 2 82,807,835 (GRCm39) missense probably benign 0.00
R5974:Fsip2 UTSW 2 82,793,657 (GRCm39) missense possibly damaging 0.68
R5991:Fsip2 UTSW 2 82,820,812 (GRCm39) missense probably benign 0.28
R6019:Fsip2 UTSW 2 82,818,283 (GRCm39) missense possibly damaging 0.52
R6020:Fsip2 UTSW 2 82,822,471 (GRCm39) missense probably damaging 0.99
R6056:Fsip2 UTSW 2 82,816,017 (GRCm39) missense probably benign 0.01
R6057:Fsip2 UTSW 2 82,809,777 (GRCm39) missense probably damaging 0.99
R6139:Fsip2 UTSW 2 82,821,388 (GRCm39) missense possibly damaging 0.85
R6145:Fsip2 UTSW 2 82,824,112 (GRCm39) missense possibly damaging 0.71
R6160:Fsip2 UTSW 2 82,818,289 (GRCm39) nonsense probably null
R6161:Fsip2 UTSW 2 82,817,601 (GRCm39) missense possibly damaging 0.80
R6166:Fsip2 UTSW 2 82,811,071 (GRCm39) missense probably benign 0.00
R6187:Fsip2 UTSW 2 82,812,798 (GRCm39) missense probably benign 0.33
R6196:Fsip2 UTSW 2 82,820,227 (GRCm39) missense possibly damaging 0.71
R6217:Fsip2 UTSW 2 82,818,762 (GRCm39) missense possibly damaging 0.93
R6276:Fsip2 UTSW 2 82,810,785 (GRCm39) missense possibly damaging 0.91
R6278:Fsip2 UTSW 2 82,819,242 (GRCm39) missense probably benign 0.16
R6349:Fsip2 UTSW 2 82,823,416 (GRCm39) missense probably benign 0.05
R6351:Fsip2 UTSW 2 82,823,028 (GRCm39) missense possibly damaging 0.51
R6401:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6404:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6405:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6437:Fsip2 UTSW 2 82,813,836 (GRCm39) missense possibly damaging 0.73
R6478:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6479:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6480:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6481:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6521:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6529:Fsip2 UTSW 2 82,812,657 (GRCm39) missense probably benign
R6621:Fsip2 UTSW 2 82,820,158 (GRCm39) missense possibly damaging 0.93
R6639:Fsip2 UTSW 2 82,813,571 (GRCm39) missense possibly damaging 0.85
R6649:Fsip2 UTSW 2 82,798,161 (GRCm39) missense possibly damaging 0.83
R6714:Fsip2 UTSW 2 82,820,430 (GRCm39) missense possibly damaging 0.71
R6714:Fsip2 UTSW 2 82,809,878 (GRCm39) missense probably benign 0.01
R6749:Fsip2 UTSW 2 82,808,738 (GRCm39) missense possibly damaging 0.85
R6765:Fsip2 UTSW 2 82,816,776 (GRCm39) missense probably benign
R6790:Fsip2 UTSW 2 82,821,283 (GRCm39) missense possibly damaging 0.53
R6793:Fsip2 UTSW 2 82,819,838 (GRCm39) missense probably benign 0.43
R6795:Fsip2 UTSW 2 82,811,303 (GRCm39) missense probably benign 0.08
R6818:Fsip2 UTSW 2 82,815,544 (GRCm39) missense probably benign 0.04
R6844:Fsip2 UTSW 2 82,813,969 (GRCm39) missense possibly damaging 0.72
R6848:Fsip2 UTSW 2 82,813,131 (GRCm39) missense probably benign 0.26
R6945:Fsip2 UTSW 2 82,823,184 (GRCm39) missense probably benign 0.16
R6950:Fsip2 UTSW 2 82,816,332 (GRCm39) missense probably benign 0.03
R6951:Fsip2 UTSW 2 82,812,293 (GRCm39) missense possibly damaging 0.68
R6974:Fsip2 UTSW 2 82,809,061 (GRCm39) missense probably damaging 0.96
R6987:Fsip2 UTSW 2 82,778,630 (GRCm39) nonsense probably null
R6989:Fsip2 UTSW 2 82,807,298 (GRCm39) missense probably benign 0.00
R7001:Fsip2 UTSW 2 82,817,269 (GRCm39) missense probably damaging 1.00
R7002:Fsip2 UTSW 2 82,819,687 (GRCm39) missense possibly damaging 0.86
R7016:Fsip2 UTSW 2 82,820,979 (GRCm39) missense probably benign 0.25
R7066:Fsip2 UTSW 2 82,821,235 (GRCm39) missense possibly damaging 0.86
R7067:Fsip2 UTSW 2 82,811,078 (GRCm39) missense possibly damaging 0.85
R7077:Fsip2 UTSW 2 82,813,496 (GRCm39) missense probably benign 0.18
R7099:Fsip2 UTSW 2 82,817,968 (GRCm39) missense probably benign
R7126:Fsip2 UTSW 2 82,813,485 (GRCm39) missense possibly damaging 0.53
R7156:Fsip2 UTSW 2 82,813,085 (GRCm39) missense probably benign 0.00
R7165:Fsip2 UTSW 2 82,811,541 (GRCm39) missense possibly damaging 0.77
R7171:Fsip2 UTSW 2 82,816,571 (GRCm39) nonsense probably null
R7189:Fsip2 UTSW 2 82,823,581 (GRCm39) missense possibly damaging 0.92
R7217:Fsip2 UTSW 2 82,819,412 (GRCm39) missense possibly damaging 0.85
R7222:Fsip2 UTSW 2 82,814,015 (GRCm39) missense probably benign
R7228:Fsip2 UTSW 2 82,822,651 (GRCm39) missense possibly damaging 0.93
R7238:Fsip2 UTSW 2 82,812,484 (GRCm39) missense possibly damaging 0.72
R7244:Fsip2 UTSW 2 82,823,607 (GRCm39) missense possibly damaging 0.92
R7251:Fsip2 UTSW 2 82,809,425 (GRCm39) missense possibly damaging 0.95
R7259:Fsip2 UTSW 2 82,812,474 (GRCm39) missense possibly damaging 0.85
R7291:Fsip2 UTSW 2 82,810,863 (GRCm39) missense possibly damaging 0.91
R7316:Fsip2 UTSW 2 82,820,035 (GRCm39) missense possibly damaging 0.93
R7323:Fsip2 UTSW 2 82,819,860 (GRCm39) missense probably benign 0.07
R7335:Fsip2 UTSW 2 82,813,462 (GRCm39) missense probably benign
R7343:Fsip2 UTSW 2 82,809,711 (GRCm39) missense probably benign 0.07
R7346:Fsip2 UTSW 2 82,828,524 (GRCm39) missense probably benign 0.00
R7389:Fsip2 UTSW 2 82,819,140 (GRCm39) missense possibly damaging 0.51
R7391:Fsip2 UTSW 2 82,820,663 (GRCm39) missense possibly damaging 0.70
R7397:Fsip2 UTSW 2 82,815,601 (GRCm39) missense possibly damaging 0.53
R7426:Fsip2 UTSW 2 82,810,441 (GRCm39) missense probably damaging 0.98
R7450:Fsip2 UTSW 2 82,782,024 (GRCm39) missense probably benign 0.30
R7538:Fsip2 UTSW 2 82,818,894 (GRCm39) missense possibly damaging 0.86
R7542:Fsip2 UTSW 2 82,815,196 (GRCm39) missense possibly damaging 0.96
R7549:Fsip2 UTSW 2 82,824,337 (GRCm39) missense probably damaging 0.99
R7564:Fsip2 UTSW 2 82,819,361 (GRCm39) missense probably benign 0.02
R7565:Fsip2 UTSW 2 82,779,856 (GRCm39) missense probably damaging 0.97
R7583:Fsip2 UTSW 2 82,805,585 (GRCm39) missense probably benign 0.12
R7641:Fsip2 UTSW 2 82,817,256 (GRCm39) nonsense probably null
R7655:Fsip2 UTSW 2 82,807,886 (GRCm39) missense possibly damaging 0.91
R7665:Fsip2 UTSW 2 82,812,149 (GRCm39) missense probably benign 0.03
R7672:Fsip2 UTSW 2 82,820,455 (GRCm39) missense possibly damaging 0.93
R7764:Fsip2 UTSW 2 82,811,252 (GRCm39) missense possibly damaging 0.93
R7790:Fsip2 UTSW 2 82,818,723 (GRCm39) missense probably benign
R7811:Fsip2 UTSW 2 82,828,797 (GRCm39) missense possibly damaging 0.93
R7838:Fsip2 UTSW 2 82,807,044 (GRCm39) missense probably benign 0.00
R7873:Fsip2 UTSW 2 82,779,856 (GRCm39) missense probably damaging 0.97
R7902:Fsip2 UTSW 2 82,808,168 (GRCm39) missense possibly damaging 0.72
R7920:Fsip2 UTSW 2 82,781,365 (GRCm39) missense possibly damaging 0.94
R7959:Fsip2 UTSW 2 82,816,120 (GRCm39) missense possibly damaging 0.51
R8009:Fsip2 UTSW 2 82,818,793 (GRCm39) missense possibly damaging 0.85
R8031:Fsip2 UTSW 2 82,817,235 (GRCm39) missense probably benign
R8034:Fsip2 UTSW 2 82,819,699 (GRCm39) missense possibly damaging 0.92
R8037:Fsip2 UTSW 2 82,816,322 (GRCm39) missense possibly damaging 0.72
R8110:Fsip2 UTSW 2 82,789,017 (GRCm39) missense probably benign 0.00
R8117:Fsip2 UTSW 2 82,823,296 (GRCm39) missense possibly damaging 0.86
R8138:Fsip2 UTSW 2 82,806,141 (GRCm39) missense possibly damaging 0.83
R8175:Fsip2 UTSW 2 82,818,021 (GRCm39) missense probably benign 0.16
R8175:Fsip2 UTSW 2 82,815,088 (GRCm39) missense probably benign 0.06
R8182:Fsip2 UTSW 2 82,806,951 (GRCm39) missense probably damaging 0.99
R8206:Fsip2 UTSW 2 82,820,808 (GRCm39) missense possibly damaging 0.85
R8229:Fsip2 UTSW 2 82,808,487 (GRCm39) missense possibly damaging 0.63
R8239:Fsip2 UTSW 2 82,819,687 (GRCm39) missense possibly damaging 0.71
R8245:Fsip2 UTSW 2 82,811,346 (GRCm39) missense possibly damaging 0.79
R8303:Fsip2 UTSW 2 82,818,724 (GRCm39) missense probably benign 0.00
R8336:Fsip2 UTSW 2 82,821,099 (GRCm39) missense possibly damaging 0.53
R8347:Fsip2 UTSW 2 82,818,198 (GRCm39) missense probably benign 0.16
R8351:Fsip2 UTSW 2 82,822,239 (GRCm39) missense possibly damaging 0.73
R8352:Fsip2 UTSW 2 82,814,937 (GRCm39) missense probably benign
R8419:Fsip2 UTSW 2 82,808,963 (GRCm39) missense probably damaging 0.96
R8431:Fsip2 UTSW 2 82,811,910 (GRCm39) missense probably damaging 1.00
R8439:Fsip2 UTSW 2 82,807,430 (GRCm39) missense probably benign 0.24
R8452:Fsip2 UTSW 2 82,814,937 (GRCm39) missense probably benign
R8459:Fsip2 UTSW 2 82,810,022 (GRCm39) missense possibly damaging 0.95
R8465:Fsip2 UTSW 2 82,810,284 (GRCm39) missense probably benign 0.26
R8473:Fsip2 UTSW 2 82,777,336 (GRCm39) missense probably damaging 0.99
R8703:Fsip2 UTSW 2 82,821,871 (GRCm39) missense probably damaging 0.98
R8711:Fsip2 UTSW 2 82,815,246 (GRCm39) missense possibly damaging 0.53
R8713:Fsip2 UTSW 2 82,811,453 (GRCm39) missense probably damaging 1.00
R8789:Fsip2 UTSW 2 82,815,822 (GRCm39) missense possibly damaging 0.73
R8805:Fsip2 UTSW 2 82,813,453 (GRCm39) missense possibly damaging 0.46
R8840:Fsip2 UTSW 2 82,821,606 (GRCm39) missense probably benign 0.03
R8855:Fsip2 UTSW 2 82,810,521 (GRCm39) missense probably benign 0.04
R8866:Fsip2 UTSW 2 82,810,521 (GRCm39) missense probably benign 0.04
R8875:Fsip2 UTSW 2 82,820,782 (GRCm39) missense possibly damaging 0.95
R8883:Fsip2 UTSW 2 82,809,524 (GRCm39) missense possibly damaging 0.68
R8903:Fsip2 UTSW 2 82,807,681 (GRCm39) missense possibly damaging 0.83
R8907:Fsip2 UTSW 2 82,816,984 (GRCm39) missense probably benign 0.20
R8912:Fsip2 UTSW 2 82,810,938 (GRCm39) missense probably benign
R8926:Fsip2 UTSW 2 82,823,927 (GRCm39) missense possibly damaging 0.84
R8991:Fsip2 UTSW 2 82,815,370 (GRCm39) missense probably benign 0.33
R9014:Fsip2 UTSW 2 82,806,898 (GRCm39) missense probably benign 0.32
R9014:Fsip2 UTSW 2 82,817,075 (GRCm39) missense possibly damaging 0.71
R9039:Fsip2 UTSW 2 82,828,545 (GRCm39) missense probably benign 0.32
R9054:Fsip2 UTSW 2 82,806,180 (GRCm39) missense possibly damaging 0.68
R9114:Fsip2 UTSW 2 82,807,301 (GRCm39) missense probably benign 0.00
R9124:Fsip2 UTSW 2 82,816,103 (GRCm39) missense probably benign 0.00
R9131:Fsip2 UTSW 2 82,813,170 (GRCm39) missense probably benign
R9149:Fsip2 UTSW 2 82,812,374 (GRCm39) missense possibly damaging 0.86
R9180:Fsip2 UTSW 2 82,815,574 (GRCm39) missense possibly damaging 0.96
R9192:Fsip2 UTSW 2 82,817,844 (GRCm39) missense probably benign 0.06
R9216:Fsip2 UTSW 2 82,820,425 (GRCm39) missense probably damaging 0.99
R9218:Fsip2 UTSW 2 82,823,062 (GRCm39) missense probably damaging 0.97
R9222:Fsip2 UTSW 2 82,815,958 (GRCm39) missense probably benign 0.00
R9262:Fsip2 UTSW 2 82,807,662 (GRCm39) missense probably benign 0.00
R9340:Fsip2 UTSW 2 82,818,604 (GRCm39) missense possibly damaging 0.71
R9342:Fsip2 UTSW 2 82,818,747 (GRCm39) missense possibly damaging 0.71
R9368:Fsip2 UTSW 2 82,811,039 (GRCm39) missense possibly damaging 0.68
R9372:Fsip2 UTSW 2 82,822,756 (GRCm39) missense possibly damaging 0.71
R9385:Fsip2 UTSW 2 82,819,793 (GRCm39) missense possibly damaging 0.84
R9432:Fsip2 UTSW 2 82,805,907 (GRCm39) missense probably damaging 0.98
R9434:Fsip2 UTSW 2 82,816,702 (GRCm39) missense possibly damaging 0.71
R9445:Fsip2 UTSW 2 82,806,132 (GRCm39) missense probably damaging 0.99
R9472:Fsip2 UTSW 2 82,817,285 (GRCm39) missense possibly damaging 0.85
R9496:Fsip2 UTSW 2 82,793,062 (GRCm39) missense probably benign
R9523:Fsip2 UTSW 2 82,807,972 (GRCm39) missense probably damaging 0.99
R9567:Fsip2 UTSW 2 82,798,173 (GRCm39) missense probably benign
R9636:Fsip2 UTSW 2 82,820,563 (GRCm39) missense possibly damaging 0.52
R9643:Fsip2 UTSW 2 82,821,984 (GRCm39) missense possibly damaging 0.53
R9680:Fsip2 UTSW 2 82,819,272 (GRCm39) missense probably benign 0.32
R9695:Fsip2 UTSW 2 82,806,226 (GRCm39) missense probably benign
R9705:Fsip2 UTSW 2 82,823,634 (GRCm39) missense probably benign
R9739:Fsip2 UTSW 2 82,823,896 (GRCm39) missense possibly damaging 0.71
R9751:Fsip2 UTSW 2 82,818,241 (GRCm39) missense probably benign 0.00
R9761:Fsip2 UTSW 2 82,821,994 (GRCm39) missense probably benign 0.00
R9798:Fsip2 UTSW 2 82,810,225 (GRCm39) nonsense probably null
RF003:Fsip2 UTSW 2 82,821,865 (GRCm39) missense probably benign 0.02
RF005:Fsip2 UTSW 2 82,822,876 (GRCm39) missense probably benign 0.04
RF008:Fsip2 UTSW 2 82,808,184 (GRCm39) missense probably benign
RF028:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF029:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF036:Fsip2 UTSW 2 82,814,707 (GRCm39) critical splice acceptor site probably benign
RF038:Fsip2 UTSW 2 82,824,352 (GRCm39) frame shift probably null
RF062:Fsip2 UTSW 2 82,814,707 (GRCm39) critical splice acceptor site probably benign
X0018:Fsip2 UTSW 2 82,812,851 (GRCm39) nonsense probably null
X0020:Fsip2 UTSW 2 82,781,364 (GRCm39) missense probably damaging 1.00
X0025:Fsip2 UTSW 2 82,785,290 (GRCm39) missense possibly damaging 0.70
X0027:Fsip2 UTSW 2 82,807,122 (GRCm39) missense probably benign 0.35
X0066:Fsip2 UTSW 2 82,817,807 (GRCm39) missense possibly damaging 0.51
Z1088:Fsip2 UTSW 2 82,818,978 (GRCm39) missense possibly damaging 0.85
Z1088:Fsip2 UTSW 2 82,817,997 (GRCm39) missense possibly damaging 0.86
Z1088:Fsip2 UTSW 2 82,805,792 (GRCm39) missense probably damaging 0.96
Z1176:Fsip2 UTSW 2 82,820,009 (GRCm39) missense probably benign 0.02
Z1177:Fsip2 UTSW 2 82,814,868 (GRCm39) missense probably damaging 0.98
Z1177:Fsip2 UTSW 2 82,777,304 (GRCm39) missense probably damaging 0.99
Z1177:Fsip2 UTSW 2 82,817,547 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAACAAAGGGTGGTTCACTGATCC -3'
(R):5'- ACTGCAAGATGGCTGAGGATC -3'

Sequencing Primer
(F):5'- AAAGTTGTAGAGTCCCGTGTCACC -3'
(R):5'- TCAGGATGATCACCTGTGAGC -3'
Posted On 2019-11-12