Incidental Mutation 'R0238:Nlrp9c'
ID59122
Institutional Source Beutler Lab
Gene Symbol Nlrp9c
Ensembl Gene ENSMUSG00000040614
Gene NameNLR family, pyrin domain containing 9C
SynonymsNalp9c, Nalp-zeta
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0238 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26322473-26403700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26378012 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 727 (S727P)
Ref Sequence ENSEMBL: ENSMUSP00000036041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041845] [ENSMUST00000085944]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041845
AA Change: S727P

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036041
Gene: ENSMUSG00000040614
AA Change: S727P

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 5.2e-31 PFAM
LRR 637 664 4.36e1 SMART
Blast:LRR 666 691 3e-6 BLAST
LRR 693 720 1.02e0 SMART
LRR 722 749 3e0 SMART
LRR 750 777 6.88e-4 SMART
LRR 779 806 5.06e0 SMART
LRR 807 834 1.22e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000085944
AA Change: S782P

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083106
Gene: ENSMUSG00000040614
AA Change: S782P

DomainStartEndE-ValueType
PYRIN 5 87 7.64e-22 SMART
Pfam:NACHT 143 310 2.8e-31 PFAM
LRR 631 658 7.49e0 SMART
LRR 692 719 4.36e1 SMART
Blast:LRR 721 746 8e-6 BLAST
LRR 748 775 1.02e0 SMART
LRR 777 804 3e0 SMART
LRR 805 832 6.88e-4 SMART
LRR 834 861 2.17e0 SMART
LRR 862 889 2.12e-4 SMART
LRR 919 946 1.22e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160948
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 98% (105/107)
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Col4a1 C T 8: 11,218,780 probably benign Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Cul2 A G 18: 3,414,115 probably benign Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hpn G T 7: 31,099,390 probably benign Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Il4ra T C 7: 125,575,199 probably benign Het
Ipo9 A G 1: 135,404,336 probably benign Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Lrmp G A 6: 145,171,978 probably benign Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Micu2 G A 14: 57,917,378 probably benign Het
Mpl A G 4: 118,456,863 probably benign Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nbn T C 4: 15,986,672 probably benign Het
Ndufa4 C T 6: 11,906,024 V10I probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Pzp C T 6: 128,489,156 probably benign Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Scgb1b27 G A 7: 34,021,952 probably benign Het
Sec31b G A 19: 44,525,469 probably benign Het
Six3 G A 17: 85,621,390 G51R probably damaging Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem131 T C 1: 36,828,050 probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Zfp866 T C 8: 69,766,715 Y53C probably damaging Het
Other mutations in Nlrp9c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Nlrp9c APN 7 26384588 missense probably benign 0.00
IGL00814:Nlrp9c APN 7 26384750 missense probably benign 0.23
IGL00919:Nlrp9c APN 7 26394056 nonsense probably null
IGL01762:Nlrp9c APN 7 26385425 missense probably damaging 1.00
IGL01928:Nlrp9c APN 7 26375422 splice site probably benign
IGL02008:Nlrp9c APN 7 26385151 missense probably benign 0.16
IGL02389:Nlrp9c APN 7 26394207 missense probably benign
IGL02535:Nlrp9c APN 7 26372097 missense probably damaging 1.00
IGL02685:Nlrp9c APN 7 26385557 missense probably damaging 0.98
IGL02904:Nlrp9c APN 7 26375290 missense probably damaging 1.00
IGL02935:Nlrp9c APN 7 26385276 missense probably benign 0.00
IGL03006:Nlrp9c APN 7 26372082 missense probably damaging 0.98
IGL03140:Nlrp9c APN 7 26380489 missense probably benign 0.30
IGL03201:Nlrp9c APN 7 26385108 missense probably benign 0.00
IGL03243:Nlrp9c APN 7 26365032 missense probably damaging 0.99
IGL03054:Nlrp9c UTSW 7 26382276 splice site probably null
K7894:Nlrp9c UTSW 7 26384898 missense possibly damaging 0.94
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0018:Nlrp9c UTSW 7 26371998 missense possibly damaging 0.89
R0238:Nlrp9c UTSW 7 26378012 missense possibly damaging 0.90
R0335:Nlrp9c UTSW 7 26394136 missense possibly damaging 0.92
R0391:Nlrp9c UTSW 7 26371476 splice site probably benign
R0433:Nlrp9c UTSW 7 26385819 missense probably benign 0.20
R1035:Nlrp9c UTSW 7 26371277 splice site probably benign
R1118:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1119:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1173:Nlrp9c UTSW 7 26380435 missense probably damaging 1.00
R1519:Nlrp9c UTSW 7 26378101 missense possibly damaging 0.88
R1528:Nlrp9c UTSW 7 26382298 missense probably damaging 0.99
R1616:Nlrp9c UTSW 7 26384437 missense probably benign 0.01
R1774:Nlrp9c UTSW 7 26394118 missense probably benign 0.05
R1789:Nlrp9c UTSW 7 26380490 missense probably benign 0.00
R1869:Nlrp9c UTSW 7 26384820 nonsense probably null
R1870:Nlrp9c UTSW 7 26384820 nonsense probably null
R1920:Nlrp9c UTSW 7 26384894 missense probably damaging 1.00
R1987:Nlrp9c UTSW 7 26378056 missense probably benign 0.31
R2022:Nlrp9c UTSW 7 26384796 missense probably damaging 1.00
R2309:Nlrp9c UTSW 7 26378087 missense probably damaging 1.00
R2327:Nlrp9c UTSW 7 26375322 missense probably damaging 1.00
R3405:Nlrp9c UTSW 7 26385282 missense probably benign 0.01
R3548:Nlrp9c UTSW 7 26371451 missense probably damaging 1.00
R3846:Nlrp9c UTSW 7 26382276 splice site probably null
R4179:Nlrp9c UTSW 7 26384661 missense possibly damaging 0.74
R4460:Nlrp9c UTSW 7 26378098 missense probably damaging 1.00
R4669:Nlrp9c UTSW 7 26375368 missense possibly damaging 0.90
R4708:Nlrp9c UTSW 7 26384840 missense probably benign 0.07
R4810:Nlrp9c UTSW 7 26378177 splice site probably null
R4824:Nlrp9c UTSW 7 26380564 missense possibly damaging 0.49
R4915:Nlrp9c UTSW 7 26384460 missense probably benign 0.34
R4996:Nlrp9c UTSW 7 26385747 missense possibly damaging 0.92
R5468:Nlrp9c UTSW 7 26365000 missense probably benign 0.00
R5525:Nlrp9c UTSW 7 26384501 missense probably damaging 1.00
R5526:Nlrp9c UTSW 7 26382366 missense possibly damaging 0.95
R6020:Nlrp9c UTSW 7 26384725 missense probably benign 0.08
R6175:Nlrp9c UTSW 7 26378001 splice site probably null
R6454:Nlrp9c UTSW 7 26385774 missense possibly damaging 0.91
R6493:Nlrp9c UTSW 7 26382387 missense probably damaging 1.00
R6649:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6653:Nlrp9c UTSW 7 26371322 missense probably damaging 1.00
R6739:Nlrp9c UTSW 7 26385425 missense probably damaging 0.99
R6883:Nlrp9c UTSW 7 26378131 missense probably benign 0.18
R7097:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7122:Nlrp9c UTSW 7 26385621 missense probably damaging 1.00
R7174:Nlrp9c UTSW 7 26385297 missense probably benign 0.03
R7365:Nlrp9c UTSW 7 26371397 missense possibly damaging 0.93
R7378:Nlrp9c UTSW 7 26365015 missense probably benign 0.14
R7427:Nlrp9c UTSW 7 26371435 missense probably benign 0.00
R7450:Nlrp9c UTSW 7 26364939 missense probably benign 0.45
X0065:Nlrp9c UTSW 7 26380430 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGTTCCAATCTCTTTCCAGATGC -3'
(R):5'- TGACATATCAAGTGAGGCTTGTGGC -3'

Sequencing Primer
(F):5'- CAGAAGTAGCCTTGGCTTGTC -3'
(R):5'- GTGGCATAATGGCAACTTTCC -3'
Posted On2013-07-11