Incidental Mutation 'R7656:Col14a1'
ID591224
Institutional Source Beutler Lab
Gene Symbol Col14a1
Ensembl Gene ENSMUSG00000022371
Gene Namecollagen, type XIV, alpha 1
Synonyms5730412L22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7656 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location55307750-55520803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55362450 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 170 (I170V)
Ref Sequence ENSEMBL: ENSMUSP00000105850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023053] [ENSMUST00000110217] [ENSMUST00000110221]
Predicted Effect unknown
Transcript: ENSMUST00000023053
AA Change: I170V
SMART Domains Protein: ENSMUSP00000023053
Gene: ENSMUSG00000022371
AA Change: I170V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 818 6.2e-7 SMART
FN3 830 909 1.45e-7 SMART
FN3 920 999 3.59e0 SMART
low complexity region 1010 1022 N/A INTRINSIC
VWA 1031 1211 2.02e-59 SMART
TSPN 1230 1425 1.19e-66 SMART
Pfam:Collagen 1461 1515 2.9e-8 PFAM
Pfam:Collagen 1513 1571 6.3e-9 PFAM
Pfam:Collagen 1555 1615 8.5e-10 PFAM
Pfam:Collagen 1653 1709 7.6e-10 PFAM
Pfam:Collagen 1707 1762 2.6e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110217
AA Change: I170V
SMART Domains Protein: ENSMUSP00000105846
Gene: ENSMUSG00000022371
AA Change: I170V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 819 5.4e-7 SMART
FN3 831 910 1.45e-7 SMART
FN3 921 1000 3.59e0 SMART
low complexity region 1011 1023 N/A INTRINSIC
VWA 1032 1212 2.02e-59 SMART
TSPN 1231 1426 1.19e-66 SMART
Pfam:Collagen 1462 1516 2.5e-8 PFAM
Pfam:Collagen 1514 1572 5.4e-9 PFAM
Pfam:Collagen 1556 1616 7.3e-10 PFAM
Pfam:Collagen 1654 1710 6.5e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000110221
AA Change: I170V
SMART Domains Protein: ENSMUSP00000105850
Gene: ENSMUSG00000022371
AA Change: I170V

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FN3 30 108 5.4e-7 SMART
low complexity region 122 136 N/A INTRINSIC
VWA 157 336 9.5e-56 SMART
FN3 354 434 3.82e-7 SMART
FN3 444 522 3.1e-7 SMART
FN3 536 613 5.07e-12 SMART
FN3 625 704 3.1e-7 SMART
FN3 736 815 7.12e-7 SMART
FN3 827 906 1.45e-7 SMART
FN3 917 996 3.59e0 SMART
low complexity region 1007 1019 N/A INTRINSIC
VWA 1028 1208 2.02e-59 SMART
TSPN 1227 1422 1.19e-66 SMART
Pfam:Collagen 1458 1512 8.2e-9 PFAM
Pfam:Collagen 1510 1568 1.8e-9 PFAM
Pfam:Collagen 1552 1612 2.4e-10 PFAM
Pfam:Collagen 1650 1706 2.2e-10 PFAM
Pfam:Collagen 1704 1759 7.5e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XIV collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XIV collagen interacts with the fibril surface and is involved in the regulation of fibrillogenesis. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null mutation display abnormal tendon morphology and abnormal biomechanical properties of the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot2 A G 12: 83,992,917 Y400C probably benign Het
Agbl1 A G 7: 76,409,332 M237V Het
Arntl2 A G 6: 146,806,442 T21A probably benign Het
Atrnl1 C A 19: 57,611,379 S9* probably null Het
BC031181 A T 18: 75,009,335 K71* probably null Het
Brpf1 A T 6: 113,314,874 M294L probably benign Het
Camk2g T G 14: 20,739,342 D382A possibly damaging Het
Ccdc33 T A 9: 58,118,465 R94W probably damaging Het
Cd244 T A 1: 171,577,255 L225Q probably damaging Het
Chsy1 G T 7: 66,171,030 V338F probably damaging Het
Col6a2 G T 10: 76,607,756 Q492K probably benign Het
Dnah12 G T 14: 26,859,316 V3168L probably benign Het
Dnah7a T C 1: 53,496,005 S2699G possibly damaging Het
Efhc1 A G 1: 20,961,057 probably null Het
Fam206a A G 4: 56,804,218 I78V probably benign Het
Fsip2 A G 2: 82,977,542 K1402E possibly damaging Het
Ghdc C T 11: 100,769,667 A127T probably benign Het
Glp1r T C 17: 30,930,598 probably null Het
Gm15922 T C 7: 3,739,282 E82G probably damaging Het
Gm19410 A T 8: 35,809,099 M1637L probably benign Het
Gm906 T G 13: 50,247,086 K401N probably benign Het
Grm5 T G 7: 88,130,251 D998E probably benign Het
Krtcap3 A G 5: 31,252,560 T157A probably damaging Het
Ltf A T 9: 111,024,394 K18* probably null Het
Luc7l2 A G 6: 38,603,464 R333G unknown Het
Mdc1 T G 17: 35,850,881 S895R probably benign Het
Mef2a G A 7: 67,295,394 T80M probably damaging Het
Mitd1 T A 1: 37,885,275 I65F probably benign Het
Mms19 A G 19: 41,944,572 L1026P probably damaging Het
Mtbp G T 15: 55,609,526 V629L unknown Het
Ncapd3 T A 9: 27,055,505 I545N possibly damaging Het
Nin G A 12: 70,042,768 T1291M Het
Olfr1487 A T 19: 13,619,833 I181F probably damaging Het
Olfr419 T A 1: 174,250,218 K236N probably damaging Het
Orc3 G T 4: 34,587,032 C352* probably null Het
Oxct2b G A 4: 123,117,757 G490D probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Phkg2 G A 7: 127,582,902 G365D probably damaging Het
Plekhd1 A G 12: 80,722,160 probably null Het
Ppp2r3a A T 9: 101,211,712 F471I probably benign Het
Prl3d1 T C 13: 27,100,035 C196R possibly damaging Het
Prmt1 A T 7: 44,984,128 F14L probably benign Het
Prox1 A G 1: 190,162,221 L9P probably damaging Het
Ptpn13 T A 5: 103,540,983 F881I probably benign Het
Rab3ip A G 10: 116,914,139 I363T probably benign Het
Rapgef3 T C 15: 97,761,209 E134G probably damaging Het
Rapgef6 C T 11: 54,694,453 P1559L probably benign Het
Rnf180 T C 13: 105,167,588 K507E probably damaging Het
Rpl3l T C 17: 24,730,986 I53T probably benign Het
Rtl1 T C 12: 109,591,008 I1466V unknown Het
Saxo2 A G 7: 82,635,351 Y100H probably damaging Het
Selenoh G T 2: 84,670,380 R39S probably damaging Het
Sgsm2 A G 11: 74,865,497 V342A probably damaging Het
Slc26a9 T A 1: 131,763,244 F587I possibly damaging Het
Smoc1 A T 12: 81,105,908 Q91L possibly damaging Het
Spag9 A C 11: 93,996,563 H98P possibly damaging Het
T2 T A 17: 8,418,215 C337* probably null Het
Tbc1d19 A G 5: 53,897,035 Y455C probably damaging Het
Thbd A G 2: 148,407,420 L176P probably damaging Het
Tmem116 A G 5: 121,452,189 probably null Het
Tmem25 C T 9: 44,798,343 V54I possibly damaging Het
Trpm4 C T 7: 45,321,809 V378I probably benign Het
Trrap G T 5: 144,842,612 W3129C probably damaging Het
Ttn A T 2: 76,728,316 D29740E probably damaging Het
Vcan C T 13: 89,685,114 C3073Y probably damaging Het
Xrra1 T A 7: 99,910,982 D388E probably benign Het
Other mutations in Col14a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Col14a1 APN 15 55411585 missense unknown
IGL01290:Col14a1 APN 15 55423507 missense unknown
IGL01300:Col14a1 APN 15 55467976 missense unknown
IGL01505:Col14a1 APN 15 55455223 missense unknown
IGL01533:Col14a1 APN 15 55420840 missense unknown
IGL01563:Col14a1 APN 15 55487941 missense unknown
IGL01650:Col14a1 APN 15 55406693 missense unknown
IGL01659:Col14a1 APN 15 55446172 unclassified probably benign
IGL01670:Col14a1 APN 15 55329266 missense unknown
IGL01760:Col14a1 APN 15 55423459 missense unknown
IGL01803:Col14a1 APN 15 55418814 missense unknown
IGL01966:Col14a1 APN 15 55448725 unclassified probably benign
IGL01990:Col14a1 APN 15 55363463 missense unknown
IGL02124:Col14a1 APN 15 55463703 missense unknown
IGL02138:Col14a1 APN 15 55420835 missense unknown
IGL02192:Col14a1 APN 15 55362402 missense unknown
IGL02326:Col14a1 APN 15 55418797 missense unknown
IGL02335:Col14a1 APN 15 55463769 splice site probably benign
IGL02407:Col14a1 APN 15 55448876 splice site probably benign
IGL02486:Col14a1 APN 15 55388696 splice site probably benign
IGL02537:Col14a1 APN 15 55344914 nonsense probably null
IGL02567:Col14a1 APN 15 55344961 critical splice donor site probably null
IGL02643:Col14a1 APN 15 55420862 missense unknown
IGL02669:Col14a1 APN 15 55418782 missense unknown
IGL02673:Col14a1 APN 15 55418782 missense unknown
IGL02674:Col14a1 APN 15 55418782 missense unknown
IGL03201:Col14a1 APN 15 55408904 missense unknown
IGL03334:Col14a1 APN 15 55448821 unclassified probably benign
IGL03370:Col14a1 APN 15 55488541 splice site probably null
IGL03385:Col14a1 APN 15 55410204 missense unknown
IGL03385:Col14a1 APN 15 55471708 missense unknown
PIT4131001:Col14a1 UTSW 15 55448876 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0046:Col14a1 UTSW 15 55408963 splice site probably benign
R0173:Col14a1 UTSW 15 55488532 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0242:Col14a1 UTSW 15 55497511 missense probably damaging 1.00
R0359:Col14a1 UTSW 15 55407868 splice site probably benign
R0391:Col14a1 UTSW 15 55446259 unclassified probably benign
R0468:Col14a1 UTSW 15 55388646 missense unknown
R0652:Col14a1 UTSW 15 55344882 missense unknown
R0692:Col14a1 UTSW 15 55341738 missense unknown
R0745:Col14a1 UTSW 15 55338417 missense unknown
R1006:Col14a1 UTSW 15 55519935 missense probably benign 0.04
R1331:Col14a1 UTSW 15 55410188 missense unknown
R1537:Col14a1 UTSW 15 55380767 missense unknown
R1557:Col14a1 UTSW 15 55388579 missense unknown
R1721:Col14a1 UTSW 15 55447462 unclassified probably benign
R1737:Col14a1 UTSW 15 55344961 critical splice donor site probably benign
R1837:Col14a1 UTSW 15 55382495 missense unknown
R1867:Col14a1 UTSW 15 55447462 unclassified probably benign
R1868:Col14a1 UTSW 15 55447462 unclassified probably benign
R1991:Col14a1 UTSW 15 55449940 missense unknown
R2020:Col14a1 UTSW 15 55446181 unclassified probably benign
R2103:Col14a1 UTSW 15 55449940 missense unknown
R2116:Col14a1 UTSW 15 55407764 missense unknown
R2163:Col14a1 UTSW 15 55444645 unclassified probably benign
R2207:Col14a1 UTSW 15 55463686 missense unknown
R2215:Col14a1 UTSW 15 55380842 missense unknown
R2264:Col14a1 UTSW 15 55466690 splice site probably null
R2383:Col14a1 UTSW 15 55447517 unclassified probably benign
R2397:Col14a1 UTSW 15 55338439 missense unknown
R2422:Col14a1 UTSW 15 55449922 missense unknown
R3793:Col14a1 UTSW 15 55363513 missense unknown
R4082:Col14a1 UTSW 15 55437033 missense unknown
R4112:Col14a1 UTSW 15 55363559 missense unknown
R4519:Col14a1 UTSW 15 55388579 missense unknown
R4628:Col14a1 UTSW 15 55449833 nonsense probably null
R4692:Col14a1 UTSW 15 55423468 missense unknown
R4696:Col14a1 UTSW 15 55372602 missense unknown
R4749:Col14a1 UTSW 15 55452336 missense unknown
R5324:Col14a1 UTSW 15 55338445 missense unknown
R5382:Col14a1 UTSW 15 55362436 missense unknown
R5634:Col14a1 UTSW 15 55518298 missense probably damaging 1.00
R5781:Col14a1 UTSW 15 55423512 missense unknown
R5828:Col14a1 UTSW 15 55436976 missense unknown
R5873:Col14a1 UTSW 15 55445786 unclassified probably benign
R5966:Col14a1 UTSW 15 55452383 critical splice donor site probably null
R6106:Col14a1 UTSW 15 55520008 missense probably damaging 1.00
R6135:Col14a1 UTSW 15 55380850 missense unknown
R6319:Col14a1 UTSW 15 55516169 missense probably damaging 0.99
R6475:Col14a1 UTSW 15 55445822 unclassified probably benign
R6540:Col14a1 UTSW 15 55372581 missense unknown
R6893:Col14a1 UTSW 15 55444648 unclassified probably benign
R6992:Col14a1 UTSW 15 55411562 splice site probably null
R7284:Col14a1 UTSW 15 55518319 missense probably damaging 1.00
R7404:Col14a1 UTSW 15 55388628 nonsense probably null
R7655:Col14a1 UTSW 15 55362450 missense unknown
R7715:Col14a1 UTSW 15 55487983 missense unknown
R7841:Col14a1 UTSW 15 55382480 missense unknown
R7861:Col14a1 UTSW 15 55444616 missense unknown
R7866:Col14a1 UTSW 15 55388620 missense unknown
R7902:Col14a1 UTSW 15 55501436 missense probably benign 0.16
R8041:Col14a1 UTSW 15 55455230 missense unknown
R8159:Col14a1 UTSW 15 55427928 missense unknown
R8224:Col14a1 UTSW 15 55407741 missense unknown
R8282:Col14a1 UTSW 15 55420880 missense unknown
X0023:Col14a1 UTSW 15 55423447 missense unknown
X0063:Col14a1 UTSW 15 55410215 missense unknown
Z1177:Col14a1 UTSW 15 55372570 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGATGGAACTTTACTGCGTTCTTAG -3'
(R):5'- GCTTTCAGGAACACCCATGTAG -3'

Sequencing Primer
(F):5'- GCACTAAGTTATCTGAACGACACTG -3'
(R):5'- GGAACACCCATGTAGTTGATCCTG -3'
Posted On2019-11-12