Incidental Mutation 'R7657:Plb1'
ID591259
Institutional Source Beutler Lab
Gene Symbol Plb1
Ensembl Gene ENSMUSG00000029134
Gene Namephospholipase B1
Synonyms4930539A06Rik, 4632413E21Rik, 4930433E17Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7657 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location32232708-32366520 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 32329867 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 902 (N902T)
Ref Sequence ENSEMBL: ENSMUSP00000098927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202220]
Predicted Effect probably damaging
Transcript: ENSMUST00000101376
AA Change: N902T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: N902T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202220
AA Change: N902T

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: N902T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 57 69 N/A INTRINSIC
Pfam:Lipase_GDSL 398 672 4e-20 PFAM
Pfam:Lipase_GDSL 745 1019 1.7e-17 PFAM
Pfam:Lipase_GDSL 1101 1367 4.6e-15 PFAM
transmembrane domain 1420 1442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,511 E28G possibly damaging Het
Acot6 G A 12: 84,106,530 G182D possibly damaging Het
Actl9 A G 17: 33,433,040 T25A probably benign Het
Adam26b G A 8: 43,521,542 T141I possibly damaging Het
Agl T C 3: 116,779,163 H148R Het
Angptl1 A G 1: 156,857,220 I320V probably benign Het
Arhgef10 C T 8: 14,979,893 R932C probably damaging Het
Atp13a2 A G 4: 140,992,504 E91G possibly damaging Het
Bptf T A 11: 107,074,729 E1213V probably damaging Het
C530025M09Rik A G 2: 149,830,621 V198A unknown Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Col1a2 A T 6: 4,527,152 K627M probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dctn2 T C 10: 127,266,514 Y6H probably damaging Het
Denr T C 5: 123,908,200 V31A probably damaging Het
Entpd7 T C 19: 43,725,467 F422L possibly damaging Het
Fam208b A G 13: 3,573,777 S2058P probably damaging Het
Fastkd5 G C 2: 130,616,256 P138R probably benign Het
Fmn1 G T 2: 113,525,193 A758S unknown Het
Fmo2 A G 1: 162,888,844 V58A probably damaging Het
Fmo6 A G 1: 162,922,716 I257T probably benign Het
Foxn1 T C 11: 78,365,964 T302A probably benign Het
Ganab C T 19: 8,907,357 L175F probably damaging Het
Gga1 A T 15: 78,889,127 probably null Het
Gjd3 G T 11: 98,982,760 S86* probably null Het
Gm1330 A G 2: 148,999,234 probably null Het
Gm18596 A C 10: 77,742,113 S176A unknown Het
Gnl2 A G 4: 125,030,158 S10G probably benign Het
Gpsm2 G A 3: 108,700,745 A239V probably damaging Het
Grik2 T C 10: 49,783,151 R37G probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Gtpbp3 T C 8: 71,491,121 L216P probably benign Het
Hhla1 T C 15: 65,965,459 T99A probably damaging Het
Igtp A T 11: 58,206,828 Q275L probably benign Het
Itga6 G A 2: 71,846,251 A993T probably benign Het
Jakmip3 T A 7: 139,019,174 I234N probably damaging Het
Kcnh7 A G 2: 62,736,035 F851L probably damaging Het
Krr1 A G 10: 111,975,599 Y66C probably damaging Het
Krt33a T A 11: 100,015,867 Q94L probably benign Het
Mat1a A T 14: 41,122,519 K369* probably null Het
Mbd1 T G 18: 74,274,733 L277R probably damaging Het
Mmp21 C T 7: 133,678,833 G136D probably benign Het
Mroh3 A G 1: 136,181,794 Y892H possibly damaging Het
Ncbp3 G A 11: 73,073,367 R381Q probably damaging Het
Nlrp2 T A 7: 5,319,168 I827L probably benign Het
Nrip1 T A 16: 76,294,699 probably null Het
Olfr1136 C T 2: 87,692,992 V297I probably damaging Het
Olfr1310 A G 2: 112,008,748 V146A probably benign Het
Olfr316 A T 11: 58,757,929 D88V probably benign Het
Oxt C T 2: 130,576,790 P107L possibly damaging Het
Pcdhga2 G A 18: 37,670,428 V442M probably damaging Het
Phtf1 T G 3: 103,969,113 S10A probably benign Het
Plppr3 T C 10: 79,866,438 I267V probably benign Het
Pms2 C A 5: 143,919,539 H278Q possibly damaging Het
Pmvk T A 3: 89,468,851 S154T possibly damaging Het
Polr3b T A 10: 84,655,991 M338K probably damaging Het
Ppp1r21 T A 17: 88,555,682 I283N probably damaging Het
Ptprj A T 2: 90,452,157 probably null Het
Rft1 T A 14: 30,666,767 L216H probably damaging Het
Rpl3 G A 15: 80,081,057 P174S probably benign Het
Rtl1 T C 12: 109,595,384 D7G possibly damaging Het
Slc13a2 A G 11: 78,398,397 V496A probably damaging Het
Slc14a1 A G 18: 78,113,664 probably null Het
Slc8a3 T C 12: 81,314,384 R554G probably damaging Het
Spata31d1b T C 13: 59,715,763 S242P possibly damaging Het
Spocd1 G A 4: 129,929,742 V111I Het
Stxbp5l G A 16: 37,210,172 A479V probably null Het
Tmem238 C G 7: 4,789,227 G106R probably damaging Het
Trak1 T G 9: 121,472,586 Y803D probably damaging Het
Trim5 T C 7: 104,276,677 S226G possibly damaging Het
Trim6 T A 7: 104,231,861 D282E possibly damaging Het
Ube2e2 A G 14: 18,586,997 V121A probably benign Het
Ufd1 T G 16: 18,817,963 M77R probably benign Het
Unc13c C T 9: 73,533,903 probably null Het
Wfs1 A G 5: 36,968,234 S438P probably benign Het
Zbtb6 A C 2: 37,429,075 D280E probably benign Het
Zfp595 G A 13: 67,317,753 L152F probably damaging Het
Zfpm2 A G 15: 41,103,275 E1052G possibly damaging Het
Zmym5 A G 14: 56,804,196 V150A probably benign Het
Other mutations in Plb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Plb1 APN 5 32345736 missense probably benign 0.00
IGL00542:Plb1 APN 5 32269834 missense probably benign 0.02
IGL00835:Plb1 APN 5 32364172 missense unknown
IGL00954:Plb1 APN 5 32298514 splice site probably benign
IGL01350:Plb1 APN 5 32317064 missense probably damaging 1.00
IGL01527:Plb1 APN 5 32317123 missense probably damaging 1.00
IGL01599:Plb1 APN 5 32342544 splice site probably benign
IGL01690:Plb1 APN 5 32313697 missense probably damaging 1.00
IGL01813:Plb1 APN 5 32329085 missense probably damaging 1.00
IGL01826:Plb1 APN 5 32281145 missense probably damaging 0.99
IGL02263:Plb1 APN 5 32321348 splice site probably benign
IGL02314:Plb1 APN 5 32281148 missense possibly damaging 0.93
IGL02649:Plb1 APN 5 32362568 missense probably benign 0.09
IGL02701:Plb1 APN 5 32364197 missense unknown
IGL02704:Plb1 APN 5 32353667 missense probably benign 0.03
IGL03170:Plb1 APN 5 32284902 missense probably damaging 0.99
IGL03182:Plb1 APN 5 32344915 splice site probably benign
IGL03326:Plb1 APN 5 32331327 missense probably benign 0.00
IGL03046:Plb1 UTSW 5 32328412 missense probably damaging 1.00
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0013:Plb1 UTSW 5 32349615 splice site probably benign
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0034:Plb1 UTSW 5 32273113 missense probably benign 0.16
R0330:Plb1 UTSW 5 32355357 missense probably damaging 1.00
R0413:Plb1 UTSW 5 32355362 missense probably damaging 1.00
R0721:Plb1 UTSW 5 32364195 missense unknown
R0735:Plb1 UTSW 5 32284920 missense possibly damaging 0.90
R1423:Plb1 UTSW 5 32293257 missense probably benign
R1428:Plb1 UTSW 5 32264912 missense possibly damaging 0.82
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1469:Plb1 UTSW 5 32354826 missense possibly damaging 0.46
R1694:Plb1 UTSW 5 32317277 missense probably null 0.01
R1801:Plb1 UTSW 5 32293243 missense probably damaging 1.00
R1804:Plb1 UTSW 5 32353697 missense possibly damaging 0.91
R1900:Plb1 UTSW 5 32286847 missense probably benign 0.44
R1903:Plb1 UTSW 5 32291238 missense probably damaging 1.00
R2101:Plb1 UTSW 5 32349660 missense probably damaging 1.00
R2153:Plb1 UTSW 5 32314089 missense probably damaging 1.00
R2207:Plb1 UTSW 5 32316640 missense possibly damaging 0.50
R2270:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2271:Plb1 UTSW 5 32293242 missense probably damaging 1.00
R2311:Plb1 UTSW 5 32269818 missense probably benign 0.01
R2850:Plb1 UTSW 5 32293224 missense probably benign
R3103:Plb1 UTSW 5 32328029 missense possibly damaging 0.92
R4444:Plb1 UTSW 5 32330565 missense probably benign 0.06
R4559:Plb1 UTSW 5 32332831 missense probably damaging 0.99
R4577:Plb1 UTSW 5 32247557 nonsense probably null
R4578:Plb1 UTSW 5 32247557 nonsense probably null
R4739:Plb1 UTSW 5 32349679 splice site probably null
R4747:Plb1 UTSW 5 32349659 missense probably benign 0.08
R4806:Plb1 UTSW 5 32289852 missense probably damaging 1.00
R5406:Plb1 UTSW 5 32341915 missense probably damaging 1.00
R5567:Plb1 UTSW 5 32364199 missense unknown
R5574:Plb1 UTSW 5 32329947 missense probably benign 0.13
R5588:Plb1 UTSW 5 32329949 critical splice donor site probably null
R5619:Plb1 UTSW 5 32333497 missense probably damaging 0.99
R5769:Plb1 UTSW 5 32317522 missense probably benign 0.05
R6366:Plb1 UTSW 5 32314085 missense possibly damaging 0.59
R6700:Plb1 UTSW 5 32333464 missense probably damaging 0.99
R7162:Plb1 UTSW 5 32349663 missense probably benign 0.30
R7379:Plb1 UTSW 5 32345639 missense probably damaging 1.00
R7395:Plb1 UTSW 5 32353684 missense probably benign 0.30
R7426:Plb1 UTSW 5 32321247 intron probably null
R7643:Plb1 UTSW 5 32247557 nonsense probably null
R7780:Plb1 UTSW 5 32326266 intron probably null
R8040:Plb1 UTSW 5 32273069 missense possibly damaging 0.89
R8212:Plb1 UTSW 5 32264906 missense probably damaging 1.00
X0018:Plb1 UTSW 5 32285883 missense probably benign 0.01
X0019:Plb1 UTSW 5 32353697 missense probably damaging 0.99
X0027:Plb1 UTSW 5 32270358 missense probably benign
X0028:Plb1 UTSW 5 32302675 missense probably damaging 1.00
Z1088:Plb1 UTSW 5 32310917 missense probably benign
Z1088:Plb1 UTSW 5 32310847 missense probably damaging 0.99
Z1177:Plb1 UTSW 5 32284897 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATCATGCATGGGCTCACAAC -3'
(R):5'- AGCATAGAAATTCCTGCCTGG -3'

Sequencing Primer
(F):5'- ACCCCATGAAGTAGTCCCGTG -3'
(R):5'- AGGGATCAGATCAGTCTTGACCTC -3'
Posted On2019-11-12