Incidental Mutation 'R7657:Unc13c'
ID591274
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7657 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 73533903 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably null
Transcript: ENSMUST00000075245
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000184666
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,511 E28G possibly damaging Het
Acot6 G A 12: 84,106,530 G182D possibly damaging Het
Actl9 A G 17: 33,433,040 T25A probably benign Het
Adam26b G A 8: 43,521,542 T141I possibly damaging Het
Agl T C 3: 116,779,163 H148R Het
Angptl1 A G 1: 156,857,220 I320V probably benign Het
Arhgef10 C T 8: 14,979,893 R932C probably damaging Het
Atp13a2 A G 4: 140,992,504 E91G possibly damaging Het
Bptf T A 11: 107,074,729 E1213V probably damaging Het
C530025M09Rik A G 2: 149,830,621 V198A unknown Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Col1a2 A T 6: 4,527,152 K627M probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dctn2 T C 10: 127,266,514 Y6H probably damaging Het
Denr T C 5: 123,908,200 V31A probably damaging Het
Entpd7 T C 19: 43,725,467 F422L possibly damaging Het
Fam208b A G 13: 3,573,777 S2058P probably damaging Het
Fastkd5 G C 2: 130,616,256 P138R probably benign Het
Fmn1 G T 2: 113,525,193 A758S unknown Het
Fmo2 A G 1: 162,888,844 V58A probably damaging Het
Fmo6 A G 1: 162,922,716 I257T probably benign Het
Foxn1 T C 11: 78,365,964 T302A probably benign Het
Ganab C T 19: 8,907,357 L175F probably damaging Het
Gga1 A T 15: 78,889,127 probably null Het
Gjd3 G T 11: 98,982,760 S86* probably null Het
Gm1330 A G 2: 148,999,234 probably null Het
Gm18596 A C 10: 77,742,113 S176A unknown Het
Gnl2 A G 4: 125,030,158 S10G probably benign Het
Gpsm2 G A 3: 108,700,745 A239V probably damaging Het
Grik2 T C 10: 49,783,151 R37G probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Gtpbp3 T C 8: 71,491,121 L216P probably benign Het
Hhla1 T C 15: 65,965,459 T99A probably damaging Het
Igtp A T 11: 58,206,828 Q275L probably benign Het
Itga6 G A 2: 71,846,251 A993T probably benign Het
Jakmip3 T A 7: 139,019,174 I234N probably damaging Het
Kcnh7 A G 2: 62,736,035 F851L probably damaging Het
Krr1 A G 10: 111,975,599 Y66C probably damaging Het
Krt33a T A 11: 100,015,867 Q94L probably benign Het
Mat1a A T 14: 41,122,519 K369* probably null Het
Mbd1 T G 18: 74,274,733 L277R probably damaging Het
Mmp21 C T 7: 133,678,833 G136D probably benign Het
Mroh3 A G 1: 136,181,794 Y892H possibly damaging Het
Ncbp3 G A 11: 73,073,367 R381Q probably damaging Het
Nlrp2 T A 7: 5,319,168 I827L probably benign Het
Nrip1 T A 16: 76,294,699 probably null Het
Olfr1136 C T 2: 87,692,992 V297I probably damaging Het
Olfr1310 A G 2: 112,008,748 V146A probably benign Het
Olfr316 A T 11: 58,757,929 D88V probably benign Het
Oxt C T 2: 130,576,790 P107L possibly damaging Het
Pcdhga2 G A 18: 37,670,428 V442M probably damaging Het
Phtf1 T G 3: 103,969,113 S10A probably benign Het
Plb1 A C 5: 32,329,867 N902T probably damaging Het
Plppr3 T C 10: 79,866,438 I267V probably benign Het
Pms2 C A 5: 143,919,539 H278Q possibly damaging Het
Pmvk T A 3: 89,468,851 S154T possibly damaging Het
Polr3b T A 10: 84,655,991 M338K probably damaging Het
Ppp1r21 T A 17: 88,555,682 I283N probably damaging Het
Ptprj A T 2: 90,452,157 probably null Het
Rft1 T A 14: 30,666,767 L216H probably damaging Het
Rpl3 G A 15: 80,081,057 P174S probably benign Het
Rtl1 T C 12: 109,595,384 D7G possibly damaging Het
Slc13a2 A G 11: 78,398,397 V496A probably damaging Het
Slc14a1 A G 18: 78,113,664 probably null Het
Slc8a3 T C 12: 81,314,384 R554G probably damaging Het
Spata31d1b T C 13: 59,715,763 S242P possibly damaging Het
Spocd1 G A 4: 129,929,742 V111I Het
Stxbp5l G A 16: 37,210,172 A479V probably null Het
Tmem238 C G 7: 4,789,227 G106R probably damaging Het
Trak1 T G 9: 121,472,586 Y803D probably damaging Het
Trim5 T C 7: 104,276,677 S226G possibly damaging Het
Trim6 T A 7: 104,231,861 D282E possibly damaging Het
Ube2e2 A G 14: 18,586,997 V121A probably benign Het
Ufd1 T G 16: 18,817,963 M77R probably benign Het
Wfs1 A G 5: 36,968,234 S438P probably benign Het
Zbtb6 A C 2: 37,429,075 D280E probably benign Het
Zfp595 G A 13: 67,317,753 L152F probably damaging Het
Zfpm2 A G 15: 41,103,275 E1052G possibly damaging Het
Zmym5 A G 14: 56,804,196 V150A probably benign Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7916:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7922:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7952:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R8047:Unc13c UTSW 9 73812354 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCTATTCTCTGTGGATTCATAG -3'
(R):5'- ACCTGGTACATGAGTGAGACTTGAG -3'

Sequencing Primer
(F):5'- GTGCATACTTGACAAGTGCC -3'
(R):5'- TGAGTGAGACTTGAGAGTAAATGTAC -3'
Posted On2019-11-12