Incidental Mutation 'R7657:Polr3b'
ID 591279
Institutional Source Beutler Lab
Gene Symbol Polr3b
Ensembl Gene ENSMUSG00000034453
Gene Name polymerase (RNA) III (DNA directed) polypeptide B
Synonyms RPC2, A330032P03Rik, 2700078H01Rik
MMRRC Submission
Accession Numbers

Genbank: NM_027423

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7657 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 84622292-84727178 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84655991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 338 (M338K)
Ref Sequence ENSEMBL: ENSMUSP00000076418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077175]
AlphaFold P59470
Predicted Effect probably damaging
Transcript: ENSMUST00000077175
AA Change: M338K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076418
Gene: ENSMUSG00000034453
AA Change: M338K

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 38 413 2e-55 PFAM
Pfam:RNA_pol_Rpb2_2 185 363 8.4e-29 PFAM
Pfam:RNA_pol_Rpb2_3 438 502 2.6e-22 PFAM
Pfam:RNA_pol_Rpb2_4 539 600 1e-29 PFAM
Pfam:RNA_pol_Rpb2_5 621 661 6.5e-14 PFAM
Pfam:RNA_pol_Rpb2_6 668 1041 5.8e-129 PFAM
Pfam:RNA_pol_Rpb2_7 1043 1129 7.6e-36 PFAM
Predicted Effect
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the second largest subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The largest subunit and the encoded protein form the catalytic center of RNA polymerase III. Mutations in this gene are a cause of hypomyelinating leukodystrophy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(48) : Targeted, other(2) Gene trapped(46)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,511 E28G possibly damaging Het
Acot6 G A 12: 84,106,530 G182D possibly damaging Het
Actl9 A G 17: 33,433,040 T25A probably benign Het
Adam26b G A 8: 43,521,542 T141I possibly damaging Het
Agl T C 3: 116,779,163 H148R Het
Angptl1 A G 1: 156,857,220 I320V probably benign Het
Arhgef10 C T 8: 14,979,893 R932C probably damaging Het
Atp13a2 A G 4: 140,992,504 E91G possibly damaging Het
Bptf T A 11: 107,074,729 E1213V probably damaging Het
C530025M09Rik A G 2: 149,830,621 V198A unknown Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Col1a2 A T 6: 4,527,152 K627M probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dctn2 T C 10: 127,266,514 Y6H probably damaging Het
Denr T C 5: 123,908,200 V31A probably damaging Het
Entpd7 T C 19: 43,725,467 F422L possibly damaging Het
Fam208b A G 13: 3,573,777 S2058P probably damaging Het
Fastkd5 G C 2: 130,616,256 P138R probably benign Het
Fmn1 G T 2: 113,525,193 A758S unknown Het
Fmo2 A G 1: 162,888,844 V58A probably damaging Het
Fmo6 A G 1: 162,922,716 I257T probably benign Het
Foxn1 T C 11: 78,365,964 T302A probably benign Het
Ganab C T 19: 8,907,357 L175F probably damaging Het
Gga1 A T 15: 78,889,127 probably null Het
Gjd3 G T 11: 98,982,760 S86* probably null Het
Gm1330 A G 2: 148,999,234 probably null Het
Gm18596 A C 10: 77,742,113 S176A unknown Het
Gnl2 A G 4: 125,030,158 S10G probably benign Het
Gpsm2 G A 3: 108,700,745 A239V probably damaging Het
Grik2 T C 10: 49,783,151 R37G probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Gtpbp3 T C 8: 71,491,121 L216P probably benign Het
Hhla1 T C 15: 65,965,459 T99A probably damaging Het
Igtp A T 11: 58,206,828 Q275L probably benign Het
Itga6 G A 2: 71,846,251 A993T probably benign Het
Jakmip3 T A 7: 139,019,174 I234N probably damaging Het
Kcnh7 A G 2: 62,736,035 F851L probably damaging Het
Krr1 A G 10: 111,975,599 Y66C probably damaging Het
Krt33a T A 11: 100,015,867 Q94L probably benign Het
Mat1a A T 14: 41,122,519 K369* probably null Het
Mbd1 T G 18: 74,274,733 L277R probably damaging Het
Mmp21 C T 7: 133,678,833 G136D probably benign Het
Mroh3 A G 1: 136,181,794 Y892H possibly damaging Het
Ncbp3 G A 11: 73,073,367 R381Q probably damaging Het
Nlrp2 T A 7: 5,319,168 I827L probably benign Het
Nrip1 T A 16: 76,294,699 probably null Het
Olfr1136 C T 2: 87,692,992 V297I probably damaging Het
Olfr1310 A G 2: 112,008,748 V146A probably benign Het
Olfr316 A T 11: 58,757,929 D88V probably benign Het
Oxt C T 2: 130,576,790 P107L possibly damaging Het
Pcdhga2 G A 18: 37,670,428 V442M probably damaging Het
Phtf1 T G 3: 103,969,113 S10A probably benign Het
Plb1 A C 5: 32,329,867 N902T probably damaging Het
Plppr3 T C 10: 79,866,438 I267V probably benign Het
Pms2 C A 5: 143,919,539 H278Q possibly damaging Het
Pmvk T A 3: 89,468,851 S154T possibly damaging Het
Ppp1r21 T A 17: 88,555,682 I283N probably damaging Het
Ptprj A T 2: 90,452,157 probably null Het
Rft1 T A 14: 30,666,767 L216H probably damaging Het
Rpl3 G A 15: 80,081,057 P174S probably benign Het
Rtl1 T C 12: 109,595,384 D7G possibly damaging Het
Slc13a2 A G 11: 78,398,397 V496A probably damaging Het
Slc14a1 A G 18: 78,113,664 probably null Het
Slc8a3 T C 12: 81,314,384 R554G probably damaging Het
Spata31d1b T C 13: 59,715,763 S242P possibly damaging Het
Spocd1 G A 4: 129,929,742 V111I Het
Stxbp5l G A 16: 37,210,172 A479V probably null Het
Tmem238 C G 7: 4,789,227 G106R probably damaging Het
Trak1 T G 9: 121,472,586 Y803D probably damaging Het
Trim5 T C 7: 104,276,677 S226G possibly damaging Het
Trim6 T A 7: 104,231,861 D282E possibly damaging Het
Ube2e2 A G 14: 18,586,997 V121A probably benign Het
Ufd1 T G 16: 18,817,963 M77R probably benign Het
Unc13c C T 9: 73,533,903 probably null Het
Wfs1 A G 5: 36,968,234 S438P probably benign Het
Zbtb6 A C 2: 37,429,075 D280E probably benign Het
Zfp595 G A 13: 67,317,753 L152F probably damaging Het
Zfpm2 A G 15: 41,103,275 E1052G possibly damaging Het
Zmym5 A G 14: 56,804,196 V150A probably benign Het
Other mutations in Polr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Polr3b APN 10 84676990 missense probably benign
IGL00848:Polr3b APN 10 84680377 missense probably damaging 1.00
IGL00901:Polr3b APN 10 84631796 missense possibly damaging 0.94
IGL01313:Polr3b APN 10 84725743 missense probably damaging 1.00
IGL01364:Polr3b APN 10 84695669 missense probably benign 0.00
IGL01731:Polr3b APN 10 84631840 nonsense probably null
IGL03326:Polr3b APN 10 84667395 missense probably benign 0.43
IGL03369:Polr3b APN 10 84676952 missense probably damaging 1.00
etruscan UTSW 10 84632538 missense probably benign 0.00
pennyweight UTSW 10 84713632 missense probably damaging 1.00
pinhead UTSW 10 84655991 missense probably damaging 1.00
G5538:Polr3b UTSW 10 84631794 missense probably benign 0.21
PIT4382001:Polr3b UTSW 10 84684185 missense probably damaging 1.00
R0180:Polr3b UTSW 10 84622515 missense probably benign
R0270:Polr3b UTSW 10 84718475 missense probably benign 0.02
R0541:Polr3b UTSW 10 84638064 missense probably damaging 1.00
R0890:Polr3b UTSW 10 84714336 missense probably benign 0.01
R1302:Polr3b UTSW 10 84632486 missense probably damaging 0.97
R1511:Polr3b UTSW 10 84680385 missense probably benign
R1561:Polr3b UTSW 10 84634912 missense probably damaging 1.00
R1607:Polr3b UTSW 10 84652783 missense probably benign 0.00
R1624:Polr3b UTSW 10 84679805 missense probably damaging 0.98
R1809:Polr3b UTSW 10 84693001 missense probably damaging 1.00
R1830:Polr3b UTSW 10 84692922 nonsense probably null
R2973:Polr3b UTSW 10 84628280 missense probably benign 0.00
R3401:Polr3b UTSW 10 84699491 missense probably damaging 0.96
R3876:Polr3b UTSW 10 84720518 critical splice donor site probably null
R3961:Polr3b UTSW 10 84684302 missense possibly damaging 0.89
R4664:Polr3b UTSW 10 84714369 missense probably damaging 1.00
R4721:Polr3b UTSW 10 84656003 missense possibly damaging 0.56
R4972:Polr3b UTSW 10 84638124 missense probably damaging 1.00
R5065:Polr3b UTSW 10 84632538 missense probably benign 0.00
R5264:Polr3b UTSW 10 84667416 missense probably benign 0.02
R5302:Polr3b UTSW 10 84699400 missense possibly damaging 0.59
R5795:Polr3b UTSW 10 84628252 missense probably benign
R5795:Polr3b UTSW 10 84677011 missense probably damaging 0.97
R5838:Polr3b UTSW 10 84674590 missense probably benign 0.09
R6419:Polr3b UTSW 10 84638111 missense possibly damaging 0.78
R6568:Polr3b UTSW 10 84634903 missense probably damaging 1.00
R6787:Polr3b UTSW 10 84628625 critical splice acceptor site probably null
R6913:Polr3b UTSW 10 84713632 missense probably damaging 1.00
R7405:Polr3b UTSW 10 84684179 missense probably benign
R7456:Polr3b UTSW 10 84622491 missense probably benign
R8074:Polr3b UTSW 10 84713659 missense probably damaging 1.00
R8082:Polr3b UTSW 10 84656063 missense probably damaging 1.00
R8127:Polr3b UTSW 10 84679789 missense probably benign
R8676:Polr3b UTSW 10 84680387 missense probably benign 0.00
R8744:Polr3b UTSW 10 84628624 splice site probably benign
R8797:Polr3b UTSW 10 84697015 nonsense probably null
R8866:Polr3b UTSW 10 84695691 missense probably benign 0.14
R9006:Polr3b UTSW 10 84631833 missense probably benign 0.05
R9397:Polr3b UTSW 10 84631789 missense possibly damaging 0.93
X0066:Polr3b UTSW 10 84713695 missense probably damaging 0.97
Z1177:Polr3b UTSW 10 84714293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCCTGTATACCTCTTGGG -3'
(R):5'- CACAGATTCTATTAGATTGGGATGTGG -3'

Sequencing Primer
(F):5'- ATACCTCTTGGGGTTTAGACAGC -3'
(R):5'- GGGATGTGGTCATATCTAAAATGAC -3'
Posted On 2019-11-12