Incidental Mutation 'R0238:Olfr694'
ID59128
Institutional Source Beutler Lab
Gene Symbol Olfr694
Ensembl Gene ENSMUSG00000064223
Gene Nameolfactory receptor 694
SynonymsMOR283-9, GA_x6K02T2PBJ9-9067220-9066273
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0238 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106684980-106691814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106689255 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 159 (Y159H)
Ref Sequence ENSEMBL: ENSMUSP00000151027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052535] [ENSMUST00000082091] [ENSMUST00000216118] [ENSMUST00000216895]
Predicted Effect probably benign
Transcript: ENSMUST00000052535
AA Change: Y159H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057180
Gene: ENSMUSG00000064223
AA Change: Y159H

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4.1e-43 PFAM
Pfam:7tm_1 41 290 9.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082091
AA Change: Y159H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080740
Gene: ENSMUSG00000064223
AA Change: Y159H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 7.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208331
Predicted Effect probably benign
Transcript: ENSMUST00000216118
AA Change: Y159H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216895
AA Change: Y159H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0799 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Col4a1 C T 8: 11,218,780 probably benign Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Cul2 A G 18: 3,414,115 probably benign Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hpn G T 7: 31,099,390 probably benign Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Il4ra T C 7: 125,575,199 probably benign Het
Ipo9 A G 1: 135,404,336 probably benign Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Lrmp G A 6: 145,171,978 probably benign Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Micu2 G A 14: 57,917,378 probably benign Het
Mpl A G 4: 118,456,863 probably benign Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nbn T C 4: 15,986,672 probably benign Het
Ndufa4 C T 6: 11,906,024 V10I probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pa2g4 T C 10: 128,563,642 K51R probably benign Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Pzp C T 6: 128,489,156 probably benign Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Scgb1b27 G A 7: 34,021,952 probably benign Het
Sec31b G A 19: 44,525,469 probably benign Het
Six3 G A 17: 85,621,390 G51R probably damaging Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem131 T C 1: 36,828,050 probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Zfp866 T C 8: 69,766,715 Y53C probably damaging Het
Other mutations in Olfr694
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr694 APN 7 106689531 missense probably damaging 1.00
IGL01759:Olfr694 APN 7 106689333 missense probably benign 0.04
IGL02435:Olfr694 APN 7 106689503 missense probably benign 0.26
IGL02569:Olfr694 APN 7 106689642 missense probably benign 0.19
IGL02611:Olfr694 APN 7 106688789 missense probably benign 0.11
IGL02726:Olfr694 APN 7 106689370 nonsense probably null
IGL02944:Olfr694 APN 7 106689269 missense probably damaging 1.00
IGL03155:Olfr694 APN 7 106689239 missense probably damaging 1.00
R0238:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0239:Olfr694 UTSW 7 106689255 missense probably benign 0.00
R0609:Olfr694 UTSW 7 106688998 missense probably damaging 1.00
R0655:Olfr694 UTSW 7 106689425 missense probably damaging 1.00
R1562:Olfr694 UTSW 7 106688980 missense probably benign 0.01
R1641:Olfr694 UTSW 7 106689711 missense probably benign 0.36
R2144:Olfr694 UTSW 7 106688957 missense probably damaging 0.99
R4416:Olfr694 UTSW 7 106689011 missense probably benign 0.07
R4444:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4445:Olfr694 UTSW 7 106689146 missense possibly damaging 0.60
R4567:Olfr694 UTSW 7 106689213 nonsense probably null
R4739:Olfr694 UTSW 7 106689144 nonsense probably null
R4778:Olfr694 UTSW 7 106689667 missense probably damaging 0.97
R4908:Olfr694 UTSW 7 106689533 missense probably damaging 1.00
R5244:Olfr694 UTSW 7 106689189 missense probably benign 0.12
R5944:Olfr694 UTSW 7 106689646 nonsense probably null
R6260:Olfr694 UTSW 7 106688872 missense probably damaging 1.00
R6573:Olfr694 UTSW 7 106689463 missense probably benign 0.00
R6901:Olfr694 UTSW 7 106689189 missense probably benign 0.03
R7230:Olfr694 UTSW 7 106689524 missense possibly damaging 0.94
R7420:Olfr694 UTSW 7 106689020 missense possibly damaging 0.74
R7426:Olfr694 UTSW 7 106689210 missense possibly damaging 0.88
U24488:Olfr694 UTSW 7 106689089 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAACCACAGTCAGATGGGAAG -3'
(R):5'- ACTGACACTTGGTAGTGCAGAGGAC -3'

Sequencing Primer
(F):5'- CATGTGCAGCACAGTGAATAG -3'
(R):5'- TGCAGAGGACCTCCTTCTGG -3'
Posted On2013-07-11