Incidental Mutation 'R7657:Bptf'
ID 591290
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Name bromodomain PHD finger transcription factor
Synonyms Falz, 9430093H17Rik
MMRRC Submission 045733-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7657 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 106923907-107022953 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106965555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 1213 (E1213V)
Ref Sequence ENSEMBL: ENSMUSP00000102374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000057892
AA Change: E1098V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: E1098V

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106762
AA Change: E1150V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: E1150V

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106763
AA Change: E1213V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: E1213V

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,099,337 (GRCm39) E28G possibly damaging Het
Acot6 G A 12: 84,153,304 (GRCm39) G182D possibly damaging Het
Actl9 A G 17: 33,652,014 (GRCm39) T25A probably benign Het
Adam26b G A 8: 43,974,579 (GRCm39) T141I possibly damaging Het
Agl T C 3: 116,572,812 (GRCm39) H148R Het
Angptl1 A G 1: 156,684,790 (GRCm39) I320V probably benign Het
Arhgef10 C T 8: 15,029,893 (GRCm39) R932C probably damaging Het
Atp13a2 A G 4: 140,719,815 (GRCm39) E91G possibly damaging Het
C530025M09Rik A G 2: 149,672,541 (GRCm39) V198A unknown Het
Casd1 A T 6: 4,619,773 (GRCm39) I173F probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Col1a2 A T 6: 4,527,152 (GRCm39) K627M probably null Het
Ctcfl G A 2: 172,955,449 (GRCm39) T271I possibly damaging Het
Dctn2 T C 10: 127,102,383 (GRCm39) Y6H probably damaging Het
Denr T C 5: 124,046,263 (GRCm39) V31A probably damaging Het
Entpd7 T C 19: 43,713,906 (GRCm39) F422L possibly damaging Het
Fastkd5 G C 2: 130,458,176 (GRCm39) P138R probably benign Het
Fmn1 G T 2: 113,355,538 (GRCm39) A758S unknown Het
Fmo2 A G 1: 162,716,413 (GRCm39) V58A probably damaging Het
Fmo6 A G 1: 162,750,285 (GRCm39) I257T probably benign Het
Foxn1 T C 11: 78,256,790 (GRCm39) T302A probably benign Het
Ganab C T 19: 8,884,721 (GRCm39) L175F probably damaging Het
Gga1 A T 15: 78,773,327 (GRCm39) probably null Het
Gjd3 G T 11: 98,873,586 (GRCm39) S86* probably null Het
Gm1330 A G 2: 148,841,154 (GRCm39) probably null Het
Gm18596 A C 10: 77,577,947 (GRCm39) S176A unknown Het
Gnl2 A G 4: 124,923,951 (GRCm39) S10G probably benign Het
Gpsm2 G A 3: 108,608,061 (GRCm39) A239V probably damaging Het
Grik2 T C 10: 49,659,247 (GRCm39) R37G probably benign Het
Grm3 A G 5: 9,561,452 (GRCm39) probably null Het
Gtpbp3 T C 8: 71,943,765 (GRCm39) L216P probably benign Het
Hhla1 T C 15: 65,837,308 (GRCm39) T99A probably damaging Het
Igtp A T 11: 58,097,654 (GRCm39) Q275L probably benign Het
Itga6 G A 2: 71,676,595 (GRCm39) A993T probably benign Het
Jakmip3 T A 7: 138,620,903 (GRCm39) I234N probably damaging Het
Kcnh7 A G 2: 62,566,379 (GRCm39) F851L probably damaging Het
Krr1 A G 10: 111,811,504 (GRCm39) Y66C probably damaging Het
Krt33a T A 11: 99,906,693 (GRCm39) Q94L probably benign Het
Mat1a A T 14: 40,844,476 (GRCm39) K369* probably null Het
Mbd1 T G 18: 74,407,804 (GRCm39) L277R probably damaging Het
Mmp21 C T 7: 133,280,562 (GRCm39) G136D probably benign Het
Mroh3 A G 1: 136,109,532 (GRCm39) Y892H possibly damaging Het
Ncbp3 G A 11: 72,964,193 (GRCm39) R381Q probably damaging Het
Nlrp2 T A 7: 5,322,167 (GRCm39) I827L probably benign Het
Nrip1 T A 16: 76,091,587 (GRCm39) probably null Het
Or2ak4 A T 11: 58,648,755 (GRCm39) D88V probably benign Het
Or4f6 A G 2: 111,839,093 (GRCm39) V146A probably benign Het
Or5w13 C T 2: 87,523,336 (GRCm39) V297I probably damaging Het
Oxt C T 2: 130,418,710 (GRCm39) P107L possibly damaging Het
Pcdhga2 G A 18: 37,803,481 (GRCm39) V442M probably damaging Het
Phtf1 T G 3: 103,876,429 (GRCm39) S10A probably benign Het
Plb1 A C 5: 32,487,211 (GRCm39) N902T probably damaging Het
Plppr3 T C 10: 79,702,272 (GRCm39) I267V probably benign Het
Pms2 C A 5: 143,856,357 (GRCm39) H278Q possibly damaging Het
Pmvk T A 3: 89,376,158 (GRCm39) S154T possibly damaging Het
Polr3b T A 10: 84,491,855 (GRCm39) M338K probably damaging Het
Ppp1r21 T A 17: 88,863,110 (GRCm39) I283N probably damaging Het
Ptprj A T 2: 90,282,501 (GRCm39) probably null Het
Rft1 T A 14: 30,388,724 (GRCm39) L216H probably damaging Het
Rpl3 G A 15: 79,965,258 (GRCm39) P174S probably benign Het
Rtl1 T C 12: 109,561,818 (GRCm39) D7G possibly damaging Het
Slc13a2 A G 11: 78,289,223 (GRCm39) V496A probably damaging Het
Slc14a1 A G 18: 78,156,879 (GRCm39) probably null Het
Slc8a3 T C 12: 81,361,158 (GRCm39) R554G probably damaging Het
Spata31d1b T C 13: 59,863,577 (GRCm39) S242P possibly damaging Het
Spocd1 G A 4: 129,823,535 (GRCm39) V111I Het
Stxbp5l G A 16: 37,030,534 (GRCm39) A479V probably null Het
Tasor2 A G 13: 3,623,777 (GRCm39) S2058P probably damaging Het
Tmem238 C G 7: 4,792,226 (GRCm39) G106R probably damaging Het
Trak1 T G 9: 121,301,652 (GRCm39) Y803D probably damaging Het
Trim5 T C 7: 103,925,884 (GRCm39) S226G possibly damaging Het
Trim6 T A 7: 103,881,068 (GRCm39) D282E possibly damaging Het
Ube2e2 A G 14: 18,586,997 (GRCm38) V121A probably benign Het
Ufd1 T G 16: 18,636,713 (GRCm39) M77R probably benign Het
Unc13c C T 9: 73,441,185 (GRCm39) probably null Het
Wfs1 A G 5: 37,125,578 (GRCm39) S438P probably benign Het
Zbtb6 A C 2: 37,319,087 (GRCm39) D280E probably benign Het
Zfp595 G A 13: 67,465,817 (GRCm39) L152F probably damaging Het
Zfpm2 A G 15: 40,966,671 (GRCm39) E1052G possibly damaging Het
Zmym5 A G 14: 57,041,653 (GRCm39) V150A probably benign Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 106,946,105 (GRCm39) missense possibly damaging 0.88
IGL00664:Bptf APN 11 106,968,491 (GRCm39) missense possibly damaging 0.78
IGL00705:Bptf APN 11 106,986,534 (GRCm39) splice site probably benign
IGL00796:Bptf APN 11 106,945,376 (GRCm39) missense probably damaging 1.00
IGL00834:Bptf APN 11 106,964,754 (GRCm39) missense possibly damaging 0.59
IGL01155:Bptf APN 11 106,971,553 (GRCm39) missense probably damaging 1.00
IGL01314:Bptf APN 11 106,945,679 (GRCm39) missense probably damaging 1.00
IGL01371:Bptf APN 11 106,946,733 (GRCm39) missense probably benign 0.00
IGL01567:Bptf APN 11 106,949,600 (GRCm39) missense probably damaging 1.00
IGL01794:Bptf APN 11 106,944,047 (GRCm39) critical splice donor site probably null
IGL02108:Bptf APN 11 106,965,814 (GRCm39) missense probably benign 0.45
IGL02367:Bptf APN 11 106,964,178 (GRCm39) missense probably benign
IGL02437:Bptf APN 11 106,965,521 (GRCm39) missense probably benign 0.00
IGL02589:Bptf APN 11 107,002,357 (GRCm39) missense possibly damaging 0.92
IGL02897:Bptf APN 11 106,937,947 (GRCm39) missense probably damaging 1.00
IGL02935:Bptf APN 11 106,971,625 (GRCm39) missense probably damaging 1.00
IGL02954:Bptf APN 11 106,945,575 (GRCm39) missense possibly damaging 0.89
IGL02982:Bptf APN 11 106,967,500 (GRCm39) missense probably damaging 1.00
IGL03109:Bptf APN 11 106,952,527 (GRCm39) missense possibly damaging 0.53
IGL03265:Bptf APN 11 106,945,454 (GRCm39) missense probably benign 0.00
IGL03403:Bptf APN 11 106,990,559 (GRCm39) missense possibly damaging 0.51
Anodyne UTSW 11 106,934,457 (GRCm39) critical splice donor site probably null
Arroyo UTSW 11 106,933,516 (GRCm39) missense probably benign 0.32
mojado UTSW 11 106,935,466 (GRCm39) missense probably benign 0.03
IGL03097:Bptf UTSW 11 106,968,506 (GRCm39) missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 106,945,614 (GRCm39) missense probably damaging 0.98
R0066:Bptf UTSW 11 106,952,962 (GRCm39) missense possibly damaging 0.90
R0157:Bptf UTSW 11 106,965,484 (GRCm39) missense possibly damaging 0.89
R0320:Bptf UTSW 11 106,963,645 (GRCm39) missense probably damaging 1.00
R0328:Bptf UTSW 11 106,937,953 (GRCm39) missense probably damaging 1.00
R0402:Bptf UTSW 11 106,964,940 (GRCm39) missense probably damaging 1.00
R0482:Bptf UTSW 11 106,972,088 (GRCm39) missense probably benign 0.13
R0574:Bptf UTSW 11 106,967,353 (GRCm39) missense probably damaging 1.00
R0598:Bptf UTSW 11 106,963,791 (GRCm39) missense probably damaging 0.99
R0599:Bptf UTSW 11 106,959,208 (GRCm39) missense probably damaging 1.00
R0601:Bptf UTSW 11 106,952,518 (GRCm39) missense probably benign 0.04
R0744:Bptf UTSW 11 107,001,638 (GRCm39) critical splice donor site probably null
R0836:Bptf UTSW 11 107,001,638 (GRCm39) critical splice donor site probably null
R0885:Bptf UTSW 11 106,934,617 (GRCm39) missense probably damaging 1.00
R1070:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1252:Bptf UTSW 11 106,964,077 (GRCm39) missense probably benign 0.00
R1370:Bptf UTSW 11 106,937,920 (GRCm39) missense probably damaging 0.99
R1428:Bptf UTSW 11 106,963,873 (GRCm39) missense probably damaging 0.99
R1467:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1467:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1742:Bptf UTSW 11 107,001,777 (GRCm39) missense probably damaging 1.00
R1816:Bptf UTSW 11 106,951,405 (GRCm39) missense probably damaging 1.00
R1858:Bptf UTSW 11 106,964,127 (GRCm39) missense probably benign 0.00
R1989:Bptf UTSW 11 106,965,652 (GRCm39) missense probably damaging 1.00
R2253:Bptf UTSW 11 107,002,148 (GRCm39) missense probably damaging 1.00
R2392:Bptf UTSW 11 106,963,573 (GRCm39) missense probably damaging 1.00
R2431:Bptf UTSW 11 106,938,066 (GRCm39) missense possibly damaging 0.48
R3022:Bptf UTSW 11 107,002,463 (GRCm39) critical splice acceptor site probably null
R3161:Bptf UTSW 11 106,965,302 (GRCm39) missense probably damaging 1.00
R3686:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3687:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3688:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3787:Bptf UTSW 11 106,964,653 (GRCm39) missense probably damaging 1.00
R3834:Bptf UTSW 11 106,964,683 (GRCm39) missense probably benign 0.05
R3885:Bptf UTSW 11 106,965,339 (GRCm39) missense probably damaging 0.97
R4090:Bptf UTSW 11 106,972,349 (GRCm39) missense probably damaging 0.99
R4398:Bptf UTSW 11 107,001,670 (GRCm39) missense probably damaging 1.00
R4437:Bptf UTSW 11 106,965,300 (GRCm39) missense possibly damaging 0.59
R4514:Bptf UTSW 11 106,968,518 (GRCm39) missense probably damaging 1.00
R4565:Bptf UTSW 11 106,963,836 (GRCm39) missense probably damaging 1.00
R4715:Bptf UTSW 11 106,938,007 (GRCm39) missense probably damaging 1.00
R4748:Bptf UTSW 11 106,986,706 (GRCm39) missense probably damaging 0.96
R4764:Bptf UTSW 11 106,934,520 (GRCm39) missense probably damaging 1.00
R4885:Bptf UTSW 11 106,965,474 (GRCm39) missense probably benign 0.39
R4901:Bptf UTSW 11 107,001,686 (GRCm39) nonsense probably null
R4995:Bptf UTSW 11 106,945,391 (GRCm39) missense probably damaging 0.98
R5057:Bptf UTSW 11 106,973,354 (GRCm39) missense probably damaging 0.98
R5120:Bptf UTSW 11 106,964,211 (GRCm39) missense probably damaging 0.99
R5320:Bptf UTSW 11 106,972,193 (GRCm39) nonsense probably null
R5329:Bptf UTSW 11 106,964,121 (GRCm39) missense probably benign 0.06
R5418:Bptf UTSW 11 107,002,120 (GRCm39) missense probably damaging 1.00
R5461:Bptf UTSW 11 106,952,590 (GRCm39) missense probably damaging 1.00
R5664:Bptf UTSW 11 106,964,525 (GRCm39) missense probably benign 0.01
R5718:Bptf UTSW 11 107,002,260 (GRCm39) missense probably damaging 1.00
R5774:Bptf UTSW 11 107,001,963 (GRCm39) missense probably damaging 1.00
R5851:Bptf UTSW 11 107,001,688 (GRCm39) missense probably damaging 1.00
R5930:Bptf UTSW 11 106,964,022 (GRCm39) missense probably damaging 1.00
R5949:Bptf UTSW 11 107,001,915 (GRCm39) missense probably damaging 0.99
R5975:Bptf UTSW 11 106,926,690 (GRCm39) utr 3 prime probably benign
R6027:Bptf UTSW 11 106,965,771 (GRCm39) missense probably damaging 1.00
R6128:Bptf UTSW 11 106,965,516 (GRCm39) missense possibly damaging 0.87
R6337:Bptf UTSW 11 106,949,605 (GRCm39) missense possibly damaging 0.89
R6407:Bptf UTSW 11 107,001,952 (GRCm39) missense probably damaging 1.00
R6470:Bptf UTSW 11 106,963,593 (GRCm39) missense probably damaging 1.00
R6487:Bptf UTSW 11 106,968,552 (GRCm39) missense probably damaging 0.99
R6501:Bptf UTSW 11 106,968,509 (GRCm39) missense probably null 1.00
R6755:Bptf UTSW 11 106,938,082 (GRCm39) missense probably benign 0.27
R6861:Bptf UTSW 11 106,953,391 (GRCm39) missense probably damaging 1.00
R6866:Bptf UTSW 11 106,964,406 (GRCm39) missense probably damaging 1.00
R6879:Bptf UTSW 11 106,933,516 (GRCm39) missense probably benign 0.32
R6927:Bptf UTSW 11 106,945,421 (GRCm39) missense probably damaging 1.00
R6944:Bptf UTSW 11 106,971,649 (GRCm39) missense probably damaging 1.00
R7082:Bptf UTSW 11 106,977,573 (GRCm39) missense probably benign 0.00
R7136:Bptf UTSW 11 106,990,541 (GRCm39) missense probably damaging 1.00
R7162:Bptf UTSW 11 106,934,457 (GRCm39) critical splice donor site probably null
R7171:Bptf UTSW 11 107,022,233 (GRCm39) missense unknown
R7193:Bptf UTSW 11 106,945,635 (GRCm39) nonsense probably null
R7210:Bptf UTSW 11 106,945,290 (GRCm39) nonsense probably null
R7221:Bptf UTSW 11 106,945,658 (GRCm39) missense probably damaging 1.00
R7316:Bptf UTSW 11 107,001,740 (GRCm39) nonsense probably null
R7316:Bptf UTSW 11 106,963,935 (GRCm39) missense probably damaging 1.00
R7422:Bptf UTSW 11 106,951,384 (GRCm39) missense probably damaging 1.00
R7454:Bptf UTSW 11 106,935,466 (GRCm39) missense probably benign 0.03
R7718:Bptf UTSW 11 106,972,282 (GRCm39) missense possibly damaging 0.65
R7827:Bptf UTSW 11 106,938,013 (GRCm39) missense probably benign 0.01
R7844:Bptf UTSW 11 106,964,887 (GRCm39) missense probably damaging 0.97
R7992:Bptf UTSW 11 107,001,709 (GRCm39) missense probably benign 0.00
R8001:Bptf UTSW 11 106,938,166 (GRCm39) nonsense probably null
R8037:Bptf UTSW 11 106,946,776 (GRCm39) missense probably damaging 1.00
R8122:Bptf UTSW 11 106,927,417 (GRCm39) critical splice acceptor site probably null
R8235:Bptf UTSW 11 106,967,458 (GRCm39) missense probably benign 0.04
R8308:Bptf UTSW 11 106,943,815 (GRCm39) missense probably damaging 0.99
R8409:Bptf UTSW 11 106,953,495 (GRCm39) missense probably damaging 1.00
R8464:Bptf UTSW 11 107,022,168 (GRCm39) missense probably benign 0.01
R8477:Bptf UTSW 11 106,943,679 (GRCm39) missense probably damaging 0.98
R8482:Bptf UTSW 11 106,934,524 (GRCm39) missense probably benign 0.19
R8515:Bptf UTSW 11 106,946,064 (GRCm39) missense possibly damaging 0.85
R8519:Bptf UTSW 11 106,952,590 (GRCm39) missense probably damaging 1.00
R8708:Bptf UTSW 11 106,964,140 (GRCm39) missense probably damaging 1.00
R8708:Bptf UTSW 11 106,964,139 (GRCm39) missense probably damaging 0.99
R8722:Bptf UTSW 11 107,022,295 (GRCm39) missense unknown
R8732:Bptf UTSW 11 106,931,206 (GRCm39) missense probably damaging 1.00
R8783:Bptf UTSW 11 107,022,357 (GRCm39) missense unknown
R8828:Bptf UTSW 11 106,945,836 (GRCm39) missense probably damaging 0.98
R9004:Bptf UTSW 11 106,945,713 (GRCm39) missense probably damaging 1.00
R9010:Bptf UTSW 11 106,964,576 (GRCm39) missense probably damaging 1.00
R9035:Bptf UTSW 11 106,963,842 (GRCm39) missense probably damaging 1.00
R9083:Bptf UTSW 11 106,959,176 (GRCm39) missense probably damaging 1.00
R9211:Bptf UTSW 11 106,946,124 (GRCm39) missense probably damaging 1.00
R9345:Bptf UTSW 11 106,971,588 (GRCm39) missense possibly damaging 0.77
R9393:Bptf UTSW 11 106,965,134 (GRCm39) missense probably benign 0.00
R9451:Bptf UTSW 11 106,935,411 (GRCm39) missense probably damaging 1.00
R9561:Bptf UTSW 11 106,964,954 (GRCm39) nonsense probably null
R9632:Bptf UTSW 11 106,952,545 (GRCm39) missense probably damaging 1.00
R9648:Bptf UTSW 11 106,943,720 (GRCm39) missense probably damaging 0.99
R9650:Bptf UTSW 11 106,935,412 (GRCm39) missense probably benign 0.15
R9658:Bptf UTSW 11 107,002,170 (GRCm39) missense probably damaging 1.00
R9775:Bptf UTSW 11 106,934,502 (GRCm39) missense probably benign 0.04
R9776:Bptf UTSW 11 106,969,396 (GRCm39) missense probably damaging 1.00
Z1088:Bptf UTSW 11 106,965,408 (GRCm39) missense probably benign 0.00
Z1176:Bptf UTSW 11 106,949,510 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTTAGACTAGGAGGACTGATG -3'
(R):5'- ACAGAGTCACACGTGAGCAG -3'

Sequencing Primer
(F):5'- CCAAGGGATCACTTTGTGAGC -3'
(R):5'- AGTCACACGTGAGCAGTCTGG -3'
Posted On 2019-11-12