Incidental Mutation 'R7657:Stxbp5l'
ID591304
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Namesyntaxin binding protein 5-like
Synonymst2md1, insulin level locus 1, tomosyn-2, T2dm1, A830015P08Rik, LLGL4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7657 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location37114942-37384962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 37210172 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 479 (A479V)
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114775] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
Predicted Effect probably benign
Transcript: ENSMUST00000114775
SMART Domains Protein: ENSMUSP00000110423
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 3.5e-45 PFAM
Blast:WD40 397 466 6e-43 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114780
AA Change: A479V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829
AA Change: A479V

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114781
AA Change: A479V

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: A479V

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114782
AA Change: A479V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829
AA Change: A479V

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114787
AA Change: A479V

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: A479V

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,511 E28G possibly damaging Het
Acot6 G A 12: 84,106,530 G182D possibly damaging Het
Actl9 A G 17: 33,433,040 T25A probably benign Het
Adam26b G A 8: 43,521,542 T141I possibly damaging Het
Agl T C 3: 116,779,163 H148R Het
Angptl1 A G 1: 156,857,220 I320V probably benign Het
Arhgef10 C T 8: 14,979,893 R932C probably damaging Het
Atp13a2 A G 4: 140,992,504 E91G possibly damaging Het
Bptf T A 11: 107,074,729 E1213V probably damaging Het
C530025M09Rik A G 2: 149,830,621 V198A unknown Het
Casd1 A T 6: 4,619,773 I173F probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Col1a2 A T 6: 4,527,152 K627M probably null Het
Ctcfl G A 2: 173,113,656 T271I possibly damaging Het
Dctn2 T C 10: 127,266,514 Y6H probably damaging Het
Denr T C 5: 123,908,200 V31A probably damaging Het
Entpd7 T C 19: 43,725,467 F422L possibly damaging Het
Fam208b A G 13: 3,573,777 S2058P probably damaging Het
Fastkd5 G C 2: 130,616,256 P138R probably benign Het
Fmn1 G T 2: 113,525,193 A758S unknown Het
Fmo2 A G 1: 162,888,844 V58A probably damaging Het
Fmo6 A G 1: 162,922,716 I257T probably benign Het
Foxn1 T C 11: 78,365,964 T302A probably benign Het
Ganab C T 19: 8,907,357 L175F probably damaging Het
Gjd3 G T 11: 98,982,760 S86* probably null Het
Gm1330 A G 2: 148,999,234 probably null Het
Gm18596 A C 10: 77,742,113 S176A unknown Het
Gnl2 A G 4: 125,030,158 S10G probably benign Het
Gpsm2 G A 3: 108,700,745 A239V probably damaging Het
Grik2 T C 10: 49,783,151 R37G probably benign Het
Grm3 A G 5: 9,511,452 probably null Het
Hhla1 T C 15: 65,965,459 T99A probably damaging Het
Igtp A T 11: 58,206,828 Q275L probably benign Het
Itga6 G A 2: 71,846,251 A993T probably benign Het
Jakmip3 T A 7: 139,019,174 I234N probably damaging Het
Kcnh7 A G 2: 62,736,035 F851L probably damaging Het
Krr1 A G 10: 111,975,599 Y66C probably damaging Het
Krt33a T A 11: 100,015,867 Q94L probably benign Het
Mat1a A T 14: 41,122,519 K369* probably null Het
Mbd1 T G 18: 74,274,733 L277R probably damaging Het
Mmp21 C T 7: 133,678,833 G136D probably benign Het
Mroh3 A G 1: 136,181,794 Y892H possibly damaging Het
Ncbp3 G A 11: 73,073,367 R381Q probably damaging Het
Nlrp2 T A 7: 5,319,168 I827L probably benign Het
Olfr1136 C T 2: 87,692,992 V297I probably damaging Het
Olfr1310 A G 2: 112,008,748 V146A probably benign Het
Olfr316 A T 11: 58,757,929 D88V probably benign Het
Oxt C T 2: 130,576,790 P107L possibly damaging Het
Pcdhga2 G A 18: 37,670,428 V442M probably damaging Het
Phtf1 T G 3: 103,969,113 S10A probably benign Het
Plb1 A C 5: 32,329,867 N902T probably damaging Het
Plppr3 T C 10: 79,866,438 I267V probably benign Het
Pms2 C A 5: 143,919,539 H278Q possibly damaging Het
Pmvk T A 3: 89,468,851 S154T possibly damaging Het
Polr3b T A 10: 84,655,991 M338K probably damaging Het
Ppp1r21 T A 17: 88,555,682 I283N probably damaging Het
Rft1 T A 14: 30,666,767 L216H probably damaging Het
Rtl1 T C 12: 109,595,384 D7G possibly damaging Het
Slc13a2 A G 11: 78,398,397 V496A probably damaging Het
Slc14a1 A G 18: 78,113,664 probably null Het
Slc8a3 T C 12: 81,314,384 R554G probably damaging Het
Spata31d1b T C 13: 59,715,763 S242P possibly damaging Het
Spocd1 G A 4: 129,929,742 V111I Het
Tmem238 C G 7: 4,789,227 G106R probably damaging Het
Trak1 T G 9: 121,472,586 Y803D probably damaging Het
Trim5 T C 7: 104,276,677 S226G possibly damaging Het
Trim6 T A 7: 104,231,861 D282E possibly damaging Het
Ube2e2 A G 14: 18,586,997 V121A probably benign Het
Ufd1 T G 16: 18,817,963 M77R probably benign Het
Unc13c C T 9: 73,533,903 probably null Het
Wfs1 A G 5: 36,968,234 S438P probably benign Het
Zbtb6 A C 2: 37,429,075 D280E probably benign Het
Zfp595 G A 13: 67,317,753 L152F probably damaging Het
Zfpm2 A G 15: 41,103,275 E1052G possibly damaging Het
Zmym5 A G 14: 56,804,196 V150A probably benign Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37208100 missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37204578 missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37215979 missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37345092 missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37200592 missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37329895 missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37208205 missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37186654 nonsense probably null
IGL03125:Stxbp5l APN 16 37186721 missense probably benign 0.02
R0058:Stxbp5l UTSW 16 37142374 missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37288308 missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37216078 splice site probably benign
R0454:Stxbp5l UTSW 16 37134284 missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 37129797 critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37208096 missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37204521 missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 37142432 missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37247869 critical splice donor site probably null
R1593:Stxbp5l UTSW 16 37116052 missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37208111 missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37290927 critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37236275 missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37216036 missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 37115667 missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37208186 missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37200642 nonsense probably null
R2918:Stxbp5l UTSW 16 37200642 nonsense probably null
R2935:Stxbp5l UTSW 16 37134189 missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37241346 nonsense probably null
R3694:Stxbp5l UTSW 16 37241346 nonsense probably null
R3695:Stxbp5l UTSW 16 37241346 nonsense probably null
R4133:Stxbp5l UTSW 16 37208119 missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37247880 missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37255884 missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37188634 missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 37134230 missense probably benign 0.18
R5105:Stxbp5l UTSW 16 37142372 missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37186654 missense probably benign 0.19
R5358:Stxbp5l UTSW 16 37174326 missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 37129851 missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37208097 missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 37129815 missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37204448 missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37188629 missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 37134341 missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37323603 missense probably damaging 1.00
Z1088:Stxbp5l UTSW 16 37204489 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCTGAAAGAGTGCCTATAGC -3'
(R):5'- GAAGTACTCTAGCCTCTGTTCTG -3'

Sequencing Primer
(F):5'- AGAGTAGAGATACTTTAAGCTG -3'
(R):5'- ACTCTAGCCTCTGTTCTGTAGATTAG -3'
Posted On2019-11-12