Mutagenetix > Incidental Mutations

Incidental Mutation 'R7658:Nup210l'

591320

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.469) question?

Stock #

R7658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 90211993 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1874 (H1874Q)

Ref Sequence

ENSEMBL: ENSMUSP00000029548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000107373] [ENSMUST00000170122] [ENSMUST00000195998] [ENSMUST00000196205] [ENSMUST00000197361] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably benign
Transcript: ENSMUST00000029548
AA Change: H1874Q

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: H1874Q

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107373

SMART Domains

Protein: ENSMUSP00000102996
Gene: ENSMUSG00000027935

Domain	Start	End	E-Value	Type
Pfam:Miro	1	43	3.5e-6	PFAM
Pfam:Arf	1	88	1.8e-5	PFAM
Pfam:Ras	1	90	2.5e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170122

SMART Domains

Protein: ENSMUSP00000132102
Gene: ENSMUSG00000090733

Domain	Start	End	E-Value	Type
low complexity region	13	23	N/A	INTRINSIC
Pfam:Ribosomal_S27e	28	82	9.8e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195998

SMART Domains

Protein: ENSMUSP00000142942
Gene: ENSMUSG00000090733

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S27e	1	50	3e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196205

SMART Domains

Protein: ENSMUSP00000142536
Gene: ENSMUSG00000090733

Domain	Start	End	E-Value	Type
low complexity region	11	21	N/A	INTRINSIC
Pfam:Ribosomal_S27e	26	80	7.5e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197361

SMART Domains

Protein: ENSMUSP00000143402
Gene: ENSMUSG00000090733

Domain	Start	End	E-Value	Type
low complexity region	13	23	N/A	INTRINSIC
Pfam:Ribosomal_S27e	28	80	5.7e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200410
AA Change: H1874Q

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: H1874Q

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	G	T	16: 89,063,730	S72Y	unknown	Het
6430531B16Rik	T	C	7: 139,976,618	N152S	probably benign	Het
Abca8b	T	A	11: 109,935,717	K1568N	probably benign	Het
Adcy6	T	A	15: 98,596,067	Y865F	probably benign	Het
Adgrf3	A	T	5: 30,197,206	V608D	probably benign	Het
Agbl1	G	T	7: 76,766,369	A965S	unknown	Het
Agbl3	C	T	6: 34,832,508	P690L	probably benign	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Amt	A	C	9: 108,297,231	H65P	probably damaging	Het
Ankrd11	T	A	8: 122,893,664	T1150S	probably benign	Het
Arhgap15	A	C	2: 44,142,268	H288P	probably benign	Het
Arhgap39	A	T	15: 76,737,417	M328K	probably benign	Het
Arhgef12	T	C	9: 42,992,536	K743R	probably damaging	Het
Atg2a	T	G	19: 6,251,263	V789G	probably damaging	Het
Ccdc54	T	C	16: 50,590,481	T141A	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdh5	T	C	8: 104,129,401		probably null	Het
Cdkl3	T	C	11: 52,027,182	V404A	not run	Het
Chrm2	A	T	6: 36,523,249	I14F	probably benign	Het
Cnbp	T	C	6: 87,845,276	K89E	possibly damaging	Het
Cntn6	T	A	6: 104,650,483	D92E	probably benign	Het
Col15a1	T	C	4: 47,245,591	F114S	possibly damaging	Het
Csrnp1	A	G	9: 119,972,403	F530S	probably benign	Het
Dcun1d3	C	T	7: 119,857,668	V274M	probably damaging	Het
Dph2	T	A	4: 117,890,281	H302L	possibly damaging	Het
Fam162a	A	T	16: 36,046,400	Y118*	probably null	Het
Fam186a	A	G	15: 99,939,844	Y2840H	unknown	Het
Fto	A	G	8: 91,666,322	K466E	probably benign	Het
Gal	T	A	19: 3,413,309	Y41F	probably damaging	Het
Gigyf2	A	T	1: 87,419,138	L620F	unknown	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Glud1	A	T	14: 34,311,157	E87V	probably benign	Het
Gm21190	T	G	5: 15,527,925	E94A	possibly damaging	Het
Gm5592	T	C	7: 41,288,710	V472A	probably benign	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gpn2	A	G	4: 133,591,376	E304G	probably benign	Het
Gsdmc2	T	C	15: 63,825,054	T423A	probably damaging	Het
Gucy2e	G	A	11: 69,226,229	Q789*	probably null	Het
Gxylt2	T	A	6: 100,783,143	V213E	probably damaging	Het
Ighv1-75	G	A	12: 115,834,111	L64F	possibly damaging	Het
Il17re	T	C	6: 113,458,982	C30R	probably benign	Het
Il7	G	T	3: 7,604,082	D31E	probably benign	Het
Ints4	T	C	7: 97,529,253	Y687H	possibly damaging	Het
Kdelr1	T	G	7: 45,882,977	V202G	probably benign	Het
Khnyn	C	A	14: 55,887,139	Y283*	probably null	Het
Klf11	T	C	12: 24,653,671	V52A	probably damaging	Het
Klhl7	A	G	5: 24,141,286	N310S	probably benign	Het
Krt27	A	T	11: 99,349,486	L202Q	possibly damaging	Het
Lce1d	A	G	3: 92,686,047	C20R	unknown	Het
Lim2	A	T	7: 43,433,630	I80F	possibly damaging	Het
Lrrk2	T	A	15: 91,700,358	F326Y	possibly damaging	Het
Lyst	A	T	13: 13,730,476	Y3246F	possibly damaging	Het
Mafb	T	A	2: 160,366,435	H81L	possibly damaging	Het
Mfsd5	G	A	15: 102,280,877	R228H	probably benign	Het
Mmp1b	A	T	9: 7,386,675	F150I	possibly damaging	Het
Mthfd1	T	A	12: 76,270,435	L20Q	probably damaging	Het
Mxra8	A	G	4: 155,842,963	T402A	probably benign	Het
Ndc80	A	T	17: 71,508,663	L376M	probably damaging	Het
Nsd1	A	T	13: 55,277,639	R1536S	probably damaging	Het
Nyap1	T	C	5: 137,732,974	H776R	probably benign	Het
Patj	C	A	4: 98,688,179	H1773Q	probably damaging	Het
Pax8	T	A	2: 24,436,511	T280S	probably benign	Het
Pcdhb19	A	G	18: 37,498,981	T610A	probably damaging	Het
Pde2a	A	G	7: 101,511,581	D919G	possibly damaging	Het
Pdk2	T	A	11: 95,028,965	Y240F	probably damaging	Het
Peg3	A	T	7: 6,709,610	I871N	probably damaging	Het
Pex1	A	T	5: 3,596,244		probably benign	Het
Pgm2l1	C	T	7: 100,250,328	R50W	probably damaging	Het
Phkg1	T	A	5: 129,865,923	K262N	probably damaging	Het
Pik3r4	A	G	9: 105,644,511	E92G	probably damaging	Het
Prmt6	A	T	3: 110,250,385	V196E	possibly damaging	Het
Ptprn2	T	G	12: 116,722,119	M66R	probably benign	Het
Rai14	C	T	15: 10,593,103	G152R	probably damaging	Het
Recql5	A	T	11: 115,923,276	S348T	probably damaging	Het
Rfk	T	G	19: 17,398,682		probably null	Het
Selenbp1	A	T	3: 94,944,102	M389L	probably benign	Het
Sipa1l2	G	A	8: 125,492,290	R103C	probably benign	Het
Slc10a6	T	A	5: 103,629,190	S15C	probably damaging	Het
Slc12a2	G	T	18: 57,932,524	V944L	probably benign	Het
Slc16a11	T	A	11: 70,215,317	L127Q	possibly damaging	Het
St6gal1	A	G	16: 23,356,228	Y272C	probably damaging	Het
Stab2	C	A	10: 86,981,135	V133F	probably benign	Het
Stradb	G	A	1: 58,992,726	V266I	probably damaging	Het
Tmem150b	A	G	7: 4,720,759	W140R	probably benign	Het
Tnnt3	A	T	7: 142,512,096	K157*	probably null	Het
Trove2	T	C	1: 143,770,873	T45A	probably damaging	Het
Ttn	T	G	2: 76,723,769	K30863N	probably damaging	Het
Vldlr	G	A	19: 27,243,136	R592H	probably benign	Het
Vmn1r12	A	T	6: 57,158,898		probably benign	Het
Vmn2r63	A	C	7: 42,925,269	S519R	probably damaging	Het
Zbtb22	G	C	17: 33,918,497	E539Q	probably damaging	Het
Zbtb44	G	A	9: 31,054,079	A262T	probably benign	Het
Zfp280d	A	T	9: 72,324,072	N455I	probably damaging	Het
Zfp287	T	C	11: 62,725,263	N201D	probably damaging	Het
Zfp988	T	C	4: 147,332,294	L395P	probably damaging	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7735:Nup210l	UTSW	3	90185576	missense	probably damaging	1.00
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8701:Nup210l	UTSW	3	90122814	missense	probably benign	0.41
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTCCAGTTGTTTATGTGCCAAC -3'
(R):5'- GGGAATCCAGCCTCAGAAATG -3'

Sequencing Primer
(F):5'- GTTTATGTGCCAACAACAGGAAC -3'
(R):5'- GGGAATCCAGCCTCAGAAATGTAATC -3'

Posted On

2019-11-12