Incidental Mutation 'R7658:Pex1'
ID591330
Institutional Source Beutler Lab
Gene Symbol Pex1
Ensembl Gene ENSMUSG00000005907
Gene Nameperoxisomal biogenesis factor 1
Synonymsperoxisome biogenesis factor 1, ZWS1
MMRRC Submission
Accession Numbers

Genbank: NM_027777

Is this an essential gene? Possibly essential (E-score: 0.577) question?
Stock #R7658 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location3596066-3637232 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 3596244 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006061] [ENSMUST00000042753] [ENSMUST00000121291] [ENSMUST00000121877] [ENSMUST00000142516] [ENSMUST00000195894]
Predicted Effect probably benign
Transcript: ENSMUST00000006061
SMART Domains Protein: ENSMUSP00000006061
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.4e-53 PFAM
Pfam:PEX-1N 103 179 8.6e-27 PFAM
low complexity region 508 527 N/A INTRINSIC
AAA 552 702 1.39e-10 SMART
low complexity region 754 765 N/A INTRINSIC
AAA 834 970 4.07e-17 SMART
low complexity region 1024 1044 N/A INTRINSIC
low complexity region 1051 1061 N/A INTRINSIC
low complexity region 1065 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042753
SMART Domains Protein: ENSMUSP00000040952
Gene: ENSMUSG00000040302

DomainStartEndE-ValueType
Pfam:RRM_5 104 164 6.5e-11 PFAM
low complexity region 229 239 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121291
SMART Domains Protein: ENSMUSP00000113304
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 17 98 8.7e-38 PFAM
Pfam:PEX-1N 104 179 1.4e-27 PFAM
low complexity region 548 567 N/A INTRINSIC
AAA 592 742 1.39e-10 SMART
low complexity region 794 805 N/A INTRINSIC
AAA 874 1010 4.07e-17 SMART
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1091 1101 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121877
SMART Domains Protein: ENSMUSP00000112547
Gene: ENSMUSG00000040302

DomainStartEndE-ValueType
Blast:RRM 52 106 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142516
SMART Domains Protein: ENSMUSP00000116474
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
PDB:1WLF|A 1 21 5e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176000
Predicted Effect probably benign
Transcript: ENSMUST00000195894
SMART Domains Protein: ENSMUSP00000142620
Gene: ENSMUSG00000005907

DomainStartEndE-ValueType
Pfam:PEX-2N 14 99 2.5e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA ATPase family, a large group of ATPases associated with diverse cellular activities. This protein is cytoplasmic but is often anchored to a peroxisomal membrane where it forms a heteromeric complex and plays a role in the import of proteins into peroxisomes and peroxisome biogenesis. Mutations in this gene have been associated with complementation group 1 peroxisomal disorders such as neonatal adrenoleukodystrophy, infantile Refsum disease, and Zellweger syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele display premature death, postnatal growth retardation, fatty livers, a bile acid defect associated with intestinal lipid malabsorption and cholestasis, and a retinopathy associated with retinal cone cell degenerationand abnormal cone and rod electrophysiology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 89,063,730 S72Y unknown Het
6430531B16Rik T C 7: 139,976,618 N152S probably benign Het
Abca8b T A 11: 109,935,717 K1568N probably benign Het
Adcy6 T A 15: 98,596,067 Y865F probably benign Het
Adgrf3 A T 5: 30,197,206 V608D probably benign Het
Agbl1 G T 7: 76,766,369 A965S unknown Het
Agbl3 C T 6: 34,832,508 P690L probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amt A C 9: 108,297,231 H65P probably damaging Het
Ankrd11 T A 8: 122,893,664 T1150S probably benign Het
Arhgap15 A C 2: 44,142,268 H288P probably benign Het
Arhgap39 A T 15: 76,737,417 M328K probably benign Het
Arhgef12 T C 9: 42,992,536 K743R probably damaging Het
Atg2a T G 19: 6,251,263 V789G probably damaging Het
Ccdc54 T C 16: 50,590,481 T141A probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh5 T C 8: 104,129,401 probably null Het
Cdkl3 T C 11: 52,027,182 V404A not run Het
Chrm2 A T 6: 36,523,249 I14F probably benign Het
Cnbp T C 6: 87,845,276 K89E possibly damaging Het
Cntn6 T A 6: 104,650,483 D92E probably benign Het
Col15a1 T C 4: 47,245,591 F114S possibly damaging Het
Csrnp1 A G 9: 119,972,403 F530S probably benign Het
Dcun1d3 C T 7: 119,857,668 V274M probably damaging Het
Dph2 T A 4: 117,890,281 H302L possibly damaging Het
Fam162a A T 16: 36,046,400 Y118* probably null Het
Fam186a A G 15: 99,939,844 Y2840H unknown Het
Fto A G 8: 91,666,322 K466E probably benign Het
Gal T A 19: 3,413,309 Y41F probably damaging Het
Gigyf2 A T 1: 87,419,138 L620F unknown Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Glud1 A T 14: 34,311,157 E87V probably benign Het
Gm21190 T G 5: 15,527,925 E94A possibly damaging Het
Gm5592 T C 7: 41,288,710 V472A probably benign Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gpn2 A G 4: 133,591,376 E304G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Gucy2e G A 11: 69,226,229 Q789* probably null Het
Gxylt2 T A 6: 100,783,143 V213E probably damaging Het
Ighv1-75 G A 12: 115,834,111 L64F possibly damaging Het
Il17re T C 6: 113,458,982 C30R probably benign Het
Il7 G T 3: 7,604,082 D31E probably benign Het
Ints4 T C 7: 97,529,253 Y687H possibly damaging Het
Kdelr1 T G 7: 45,882,977 V202G probably benign Het
Khnyn C A 14: 55,887,139 Y283* probably null Het
Klf11 T C 12: 24,653,671 V52A probably damaging Het
Klhl7 A G 5: 24,141,286 N310S probably benign Het
Krt27 A T 11: 99,349,486 L202Q possibly damaging Het
Lce1d A G 3: 92,686,047 C20R unknown Het
Lim2 A T 7: 43,433,630 I80F possibly damaging Het
Lrrk2 T A 15: 91,700,358 F326Y possibly damaging Het
Lyst A T 13: 13,730,476 Y3246F possibly damaging Het
Mafb T A 2: 160,366,435 H81L possibly damaging Het
Mfsd5 G A 15: 102,280,877 R228H probably benign Het
Mmp1b A T 9: 7,386,675 F150I possibly damaging Het
Mthfd1 T A 12: 76,270,435 L20Q probably damaging Het
Mxra8 A G 4: 155,842,963 T402A probably benign Het
Ndc80 A T 17: 71,508,663 L376M probably damaging Het
Nsd1 A T 13: 55,277,639 R1536S probably damaging Het
Nup210l C A 3: 90,211,993 H1874Q probably benign Het
Nyap1 T C 5: 137,732,974 H776R probably benign Het
Patj C A 4: 98,688,179 H1773Q probably damaging Het
Pax8 T A 2: 24,436,511 T280S probably benign Het
Pcdhb19 A G 18: 37,498,981 T610A probably damaging Het
Pde2a A G 7: 101,511,581 D919G possibly damaging Het
Pdk2 T A 11: 95,028,965 Y240F probably damaging Het
Peg3 A T 7: 6,709,610 I871N probably damaging Het
Pgm2l1 C T 7: 100,250,328 R50W probably damaging Het
Phkg1 T A 5: 129,865,923 K262N probably damaging Het
Pik3r4 A G 9: 105,644,511 E92G probably damaging Het
Prmt6 A T 3: 110,250,385 V196E possibly damaging Het
Ptprn2 T G 12: 116,722,119 M66R probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Recql5 A T 11: 115,923,276 S348T probably damaging Het
Rfk T G 19: 17,398,682 probably null Het
Selenbp1 A T 3: 94,944,102 M389L probably benign Het
Sipa1l2 G A 8: 125,492,290 R103C probably benign Het
Slc10a6 T A 5: 103,629,190 S15C probably damaging Het
Slc12a2 G T 18: 57,932,524 V944L probably benign Het
Slc16a11 T A 11: 70,215,317 L127Q possibly damaging Het
St6gal1 A G 16: 23,356,228 Y272C probably damaging Het
Stab2 C A 10: 86,981,135 V133F probably benign Het
Stradb G A 1: 58,992,726 V266I probably damaging Het
Tmem150b A G 7: 4,720,759 W140R probably benign Het
Tnnt3 A T 7: 142,512,096 K157* probably null Het
Trove2 T C 1: 143,770,873 T45A probably damaging Het
Ttn T G 2: 76,723,769 K30863N probably damaging Het
Vldlr G A 19: 27,243,136 R592H probably benign Het
Vmn1r12 A T 6: 57,158,898 probably benign Het
Vmn2r63 A C 7: 42,925,269 S519R probably damaging Het
Zbtb22 G C 17: 33,918,497 E539Q probably damaging Het
Zbtb44 G A 9: 31,054,079 A262T probably benign Het
Zfp280d A T 9: 72,324,072 N455I probably damaging Het
Zfp287 T C 11: 62,725,263 N201D probably damaging Het
Zfp988 T C 4: 147,332,294 L395P probably damaging Het
Other mutations in Pex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Pex1 APN 5 3606027 missense probably benign 0.00
IGL01315:Pex1 APN 5 3609975 missense probably damaging 1.00
IGL01671:Pex1 APN 5 3624088 missense probably benign 0.00
IGL01863:Pex1 APN 5 3606066 missense probably benign 0.01
IGL01933:Pex1 APN 5 3633789 missense probably damaging 1.00
IGL01960:Pex1 APN 5 3627588 unclassified probably benign
IGL02347:Pex1 APN 5 3603350 missense probably damaging 0.98
IGL02374:Pex1 APN 5 3635481 missense probably benign 0.01
IGL02392:Pex1 APN 5 3605952 nonsense probably null
IGL02597:Pex1 APN 5 3635865 missense possibly damaging 0.50
IGL02703:Pex1 APN 5 3615120 missense probably benign 0.24
IGL02815:Pex1 APN 5 3636797 missense probably damaging 0.97
IGL02862:Pex1 APN 5 3605424 intron probably benign
IGL03005:Pex1 APN 5 3630292 missense probably null 0.96
E0370:Pex1 UTSW 5 3631614 splice site probably null
F5493:Pex1 UTSW 5 3635912 critical splice donor site probably null
R0014:Pex1 UTSW 5 3626141 unclassified probably benign
R0014:Pex1 UTSW 5 3626141 unclassified probably benign
R0401:Pex1 UTSW 5 3633759 missense probably damaging 1.00
R0480:Pex1 UTSW 5 3606444 splice site probably null
R0555:Pex1 UTSW 5 3606130 missense possibly damaging 0.89
R0976:Pex1 UTSW 5 3633943 missense probably benign 0.00
R1200:Pex1 UTSW 5 3606411 critical splice donor site probably null
R1672:Pex1 UTSW 5 3626085 missense probably damaging 1.00
R1753:Pex1 UTSW 5 3630044 missense probably damaging 1.00
R1880:Pex1 UTSW 5 3605770 missense probably benign
R1953:Pex1 UTSW 5 3630038 missense probably damaging 1.00
R2054:Pex1 UTSW 5 3603341 missense possibly damaging 0.78
R2081:Pex1 UTSW 5 3624132 critical splice donor site probably null
R2237:Pex1 UTSW 5 3618915 critical splice donor site probably null
R3946:Pex1 UTSW 5 3626084 missense probably damaging 1.00
R4528:Pex1 UTSW 5 3631712 missense probably damaging 1.00
R4579:Pex1 UTSW 5 3618880 missense probably benign 0.03
R4585:Pex1 UTSW 5 3633885 missense probably damaging 1.00
R4586:Pex1 UTSW 5 3633885 missense probably damaging 1.00
R4656:Pex1 UTSW 5 3604880 critical splice donor site probably null
R4789:Pex1 UTSW 5 3630270 missense probably damaging 0.98
R4850:Pex1 UTSW 5 3624426 missense probably benign
R4963:Pex1 UTSW 5 3609924 missense probably benign 0.01
R5005:Pex1 UTSW 5 3622310 missense probably damaging 1.00
R5015:Pex1 UTSW 5 3620597 missense probably damaging 1.00
R5019:Pex1 UTSW 5 3622331 missense probably damaging 1.00
R5937:Pex1 UTSW 5 3624487 missense possibly damaging 0.94
R5942:Pex1 UTSW 5 3610277 missense probably benign 0.04
R5995:Pex1 UTSW 5 3607704 missense possibly damaging 0.53
R6434:Pex1 UTSW 5 3630196 nonsense probably null
R6552:Pex1 UTSW 5 3623953 missense probably damaging 1.00
R6777:Pex1 UTSW 5 3622358 missense probably benign 0.01
R6877:Pex1 UTSW 5 3635505 missense probably benign 0.19
R6948:Pex1 UTSW 5 3605994 missense probably benign 0.00
R7317:Pex1 UTSW 5 3618875 missense probably damaging 1.00
R7408:Pex1 UTSW 5 3630222 missense probably damaging 1.00
R8062:Pex1 UTSW 5 3605656 missense probably benign
R8354:Pex1 UTSW 5 3631707 missense probably damaging 1.00
R8366:Pex1 UTSW 5 3626007 missense probably benign 0.00
R8482:Pex1 UTSW 5 3612923 missense probably benign 0.00
R8673:Pex1 UTSW 5 3635886 missense possibly damaging 0.65
R8812:Pex1 UTSW 5 3631614 missense probably benign 0.00
X0019:Pex1 UTSW 5 3605653 missense probably damaging 1.00
X0027:Pex1 UTSW 5 3630270 missense probably damaging 0.98
Z1088:Pex1 UTSW 5 3606075 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCACTGGATGCCATCTTGC -3'
(R):5'- AGTCCCGAGCATTCGTGAAG -3'

Sequencing Primer
(F):5'- GCCATCTTGCCGGCTCTAG -3'
(R):5'- ATTCGTGAAGGCCACCGTC -3'
Posted On2019-11-12