Mutagenetix > Incidental Mutations

Incidental Mutation 'R7658:Pex1'

591330

Institutional Source

Beutler Lab

Gene Symbol

Pex1

Ensembl Gene

ENSMUSG00000005907

Gene Name

peroxisomal biogenesis factor 1

Synonyms

peroxisome biogenesis factor 1, ZWS1

MMRRC Submission

Accession Numbers

Genbank: NM_027777

Is this an essential gene?

Possibly essential (E-score: 0.577) question?

Stock #

R7658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3596066-3637232 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 3596244 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000142620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006061] [ENSMUST00000042753] [ENSMUST00000121291] [ENSMUST00000121877] [ENSMUST00000142516] [ENSMUST00000195894]

Predicted Effect

probably benign
Transcript: ENSMUST00000006061

SMART Domains

Protein: ENSMUSP00000006061
Gene: ENSMUSG00000005907

Domain	Start	End	E-Value	Type
Pfam:PEX-2N	14	99	2.4e-53	PFAM
Pfam:PEX-1N	103	179	8.6e-27	PFAM
low complexity region	508	527	N/A	INTRINSIC
AAA	552	702	1.39e-10	SMART
low complexity region	754	765	N/A	INTRINSIC
AAA	834	970	4.07e-17	SMART
low complexity region	1024	1044	N/A	INTRINSIC
low complexity region	1051	1061	N/A	INTRINSIC
low complexity region	1065	1078	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000042753

SMART Domains

Protein: ENSMUSP00000040952
Gene: ENSMUSG00000040302

Domain	Start	End	E-Value	Type
Pfam:RRM_5	104	164	6.5e-11	PFAM
low complexity region	229	239	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121291

SMART Domains

Protein: ENSMUSP00000113304
Gene: ENSMUSG00000005907

Domain	Start	End	E-Value	Type
Pfam:PEX-2N	17	98	8.7e-38	PFAM
Pfam:PEX-1N	104	179	1.4e-27	PFAM
low complexity region	548	567	N/A	INTRINSIC
AAA	592	742	1.39e-10	SMART
low complexity region	794	805	N/A	INTRINSIC
AAA	874	1010	4.07e-17	SMART
low complexity region	1064	1084	N/A	INTRINSIC
low complexity region	1091	1101	N/A	INTRINSIC
low complexity region	1105	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000121877

SMART Domains

Protein: ENSMUSP00000112547
Gene: ENSMUSG00000040302

Domain	Start	End	E-Value	Type
Blast:RRM	52	106	1e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000142516

SMART Domains

Protein: ENSMUSP00000116474
Gene: ENSMUSG00000005907

Domain	Start	End	E-Value	Type
PDB:1WLF\|A	1	21	5e-8	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000176000

Predicted Effect

probably benign
Transcript: ENSMUST00000195894

SMART Domains

Protein: ENSMUSP00000142620
Gene: ENSMUSG00000005907

Domain	Start	End	E-Value	Type
Pfam:PEX-2N	14	99	2.5e-51	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA ATPase family, a large group of ATPases associated with diverse cellular activities. This protein is cytoplasmic but is often anchored to a peroxisomal membrane where it forms a heteromeric complex and plays a role in the import of proteins into peroxisomes and peroxisome biogenesis. Mutations in this gene have been associated with complementation group 1 peroxisomal disorders such as neonatal adrenoleukodystrophy, infantile Refsum disease, and Zellweger syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele display premature death, postnatal growth retardation, fatty livers, a bile acid defect associated with intestinal lipid malabsorption and cholestasis, and a retinopathy associated with retinal cone cell degenerationand abnormal cone and rod electrophysiology. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	G	T	16: 89,063,730	S72Y	unknown	Het
6430531B16Rik	T	C	7: 139,976,618	N152S	probably benign	Het
Abca8b	T	A	11: 109,935,717	K1568N	probably benign	Het
Adcy6	T	A	15: 98,596,067	Y865F	probably benign	Het
Adgrf3	A	T	5: 30,197,206	V608D	probably benign	Het
Agbl1	G	T	7: 76,766,369	A965S	unknown	Het
Agbl3	C	T	6: 34,832,508	P690L	probably benign	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Amt	A	C	9: 108,297,231	H65P	probably damaging	Het
Ankrd11	T	A	8: 122,893,664	T1150S	probably benign	Het
Arhgap15	A	C	2: 44,142,268	H288P	probably benign	Het
Arhgap39	A	T	15: 76,737,417	M328K	probably benign	Het
Arhgef12	T	C	9: 42,992,536	K743R	probably damaging	Het
Atg2a	T	G	19: 6,251,263	V789G	probably damaging	Het
Ccdc54	T	C	16: 50,590,481	T141A	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdh5	T	C	8: 104,129,401		probably null	Het
Cdkl3	T	C	11: 52,027,182	V404A	not run	Het
Chrm2	A	T	6: 36,523,249	I14F	probably benign	Het
Cnbp	T	C	6: 87,845,276	K89E	possibly damaging	Het
Cntn6	T	A	6: 104,650,483	D92E	probably benign	Het
Col15a1	T	C	4: 47,245,591	F114S	possibly damaging	Het
Csrnp1	A	G	9: 119,972,403	F530S	probably benign	Het
Dcun1d3	C	T	7: 119,857,668	V274M	probably damaging	Het
Dph2	T	A	4: 117,890,281	H302L	possibly damaging	Het
Fam162a	A	T	16: 36,046,400	Y118*	probably null	Het
Fam186a	A	G	15: 99,939,844	Y2840H	unknown	Het
Fto	A	G	8: 91,666,322	K466E	probably benign	Het
Gal	T	A	19: 3,413,309	Y41F	probably damaging	Het
Gigyf2	A	T	1: 87,419,138	L620F	unknown	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Glud1	A	T	14: 34,311,157	E87V	probably benign	Het
Gm21190	T	G	5: 15,527,925	E94A	possibly damaging	Het
Gm5592	T	C	7: 41,288,710	V472A	probably benign	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gpn2	A	G	4: 133,591,376	E304G	probably benign	Het
Gsdmc2	T	C	15: 63,825,054	T423A	probably damaging	Het
Gucy2e	G	A	11: 69,226,229	Q789*	probably null	Het
Gxylt2	T	A	6: 100,783,143	V213E	probably damaging	Het
Ighv1-75	G	A	12: 115,834,111	L64F	possibly damaging	Het
Il17re	T	C	6: 113,458,982	C30R	probably benign	Het
Il7	G	T	3: 7,604,082	D31E	probably benign	Het
Ints4	T	C	7: 97,529,253	Y687H	possibly damaging	Het
Kdelr1	T	G	7: 45,882,977	V202G	probably benign	Het
Khnyn	C	A	14: 55,887,139	Y283*	probably null	Het
Klf11	T	C	12: 24,653,671	V52A	probably damaging	Het
Klhl7	A	G	5: 24,141,286	N310S	probably benign	Het
Krt27	A	T	11: 99,349,486	L202Q	possibly damaging	Het
Lce1d	A	G	3: 92,686,047	C20R	unknown	Het
Lim2	A	T	7: 43,433,630	I80F	possibly damaging	Het
Lrrk2	T	A	15: 91,700,358	F326Y	possibly damaging	Het
Lyst	A	T	13: 13,730,476	Y3246F	possibly damaging	Het
Mafb	T	A	2: 160,366,435	H81L	possibly damaging	Het
Mfsd5	G	A	15: 102,280,877	R228H	probably benign	Het
Mmp1b	A	T	9: 7,386,675	F150I	possibly damaging	Het
Mthfd1	T	A	12: 76,270,435	L20Q	probably damaging	Het
Mxra8	A	G	4: 155,842,963	T402A	probably benign	Het
Ndc80	A	T	17: 71,508,663	L376M	probably damaging	Het
Nsd1	A	T	13: 55,277,639	R1536S	probably damaging	Het
Nup210l	C	A	3: 90,211,993	H1874Q	probably benign	Het
Nyap1	T	C	5: 137,732,974	H776R	probably benign	Het
Patj	C	A	4: 98,688,179	H1773Q	probably damaging	Het
Pax8	T	A	2: 24,436,511	T280S	probably benign	Het
Pcdhb19	A	G	18: 37,498,981	T610A	probably damaging	Het
Pde2a	A	G	7: 101,511,581	D919G	possibly damaging	Het
Pdk2	T	A	11: 95,028,965	Y240F	probably damaging	Het
Peg3	A	T	7: 6,709,610	I871N	probably damaging	Het
Pgm2l1	C	T	7: 100,250,328	R50W	probably damaging	Het
Phkg1	T	A	5: 129,865,923	K262N	probably damaging	Het
Pik3r4	A	G	9: 105,644,511	E92G	probably damaging	Het
Prmt6	A	T	3: 110,250,385	V196E	possibly damaging	Het
Ptprn2	T	G	12: 116,722,119	M66R	probably benign	Het
Rai14	C	T	15: 10,593,103	G152R	probably damaging	Het
Recql5	A	T	11: 115,923,276	S348T	probably damaging	Het
Rfk	T	G	19: 17,398,682		probably null	Het
Selenbp1	A	T	3: 94,944,102	M389L	probably benign	Het
Sipa1l2	G	A	8: 125,492,290	R103C	probably benign	Het
Slc10a6	T	A	5: 103,629,190	S15C	probably damaging	Het
Slc12a2	G	T	18: 57,932,524	V944L	probably benign	Het
Slc16a11	T	A	11: 70,215,317	L127Q	possibly damaging	Het
St6gal1	A	G	16: 23,356,228	Y272C	probably damaging	Het
Stab2	C	A	10: 86,981,135	V133F	probably benign	Het
Stradb	G	A	1: 58,992,726	V266I	probably damaging	Het
Tmem150b	A	G	7: 4,720,759	W140R	probably benign	Het
Tnnt3	A	T	7: 142,512,096	K157*	probably null	Het
Trove2	T	C	1: 143,770,873	T45A	probably damaging	Het
Ttn	T	G	2: 76,723,769	K30863N	probably damaging	Het
Vldlr	G	A	19: 27,243,136	R592H	probably benign	Het
Vmn1r12	A	T	6: 57,158,898		probably benign	Het
Vmn2r63	A	C	7: 42,925,269	S519R	probably damaging	Het
Zbtb22	G	C	17: 33,918,497	E539Q	probably damaging	Het
Zbtb44	G	A	9: 31,054,079	A262T	probably benign	Het
Zfp280d	A	T	9: 72,324,072	N455I	probably damaging	Het
Zfp287	T	C	11: 62,725,263	N201D	probably damaging	Het
Zfp988	T	C	4: 147,332,294	L395P	probably damaging	Het

Other mutations in Pex1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01287:Pex1	APN	5	3606027	missense	probably benign	0.00
IGL01315:Pex1	APN	5	3609975	missense	probably damaging	1.00
IGL01671:Pex1	APN	5	3624088	missense	probably benign	0.00
IGL01863:Pex1	APN	5	3606066	missense	probably benign	0.01
IGL01933:Pex1	APN	5	3633789	missense	probably damaging	1.00
IGL01960:Pex1	APN	5	3627588	unclassified	probably benign
IGL02347:Pex1	APN	5	3603350	missense	probably damaging	0.98
IGL02374:Pex1	APN	5	3635481	missense	probably benign	0.01
IGL02392:Pex1	APN	5	3605952	nonsense	probably null
IGL02597:Pex1	APN	5	3635865	missense	possibly damaging	0.50
IGL02703:Pex1	APN	5	3615120	missense	probably benign	0.24
IGL02815:Pex1	APN	5	3636797	missense	probably damaging	0.97
IGL02862:Pex1	APN	5	3605424	intron	probably benign
IGL03005:Pex1	APN	5	3630292	missense	probably null	0.96
E0370:Pex1	UTSW	5	3631614	splice site	probably null
F5493:Pex1	UTSW	5	3635912	critical splice donor site	probably null
R0014:Pex1	UTSW	5	3626141	unclassified	probably benign
R0014:Pex1	UTSW	5	3626141	unclassified	probably benign
R0401:Pex1	UTSW	5	3633759	missense	probably damaging	1.00
R0480:Pex1	UTSW	5	3606444	splice site	probably null
R0555:Pex1	UTSW	5	3606130	missense	possibly damaging	0.89
R0976:Pex1	UTSW	5	3633943	missense	probably benign	0.00
R1200:Pex1	UTSW	5	3606411	critical splice donor site	probably null
R1672:Pex1	UTSW	5	3626085	missense	probably damaging	1.00
R1753:Pex1	UTSW	5	3630044	missense	probably damaging	1.00
R1880:Pex1	UTSW	5	3605770	missense	probably benign
R1953:Pex1	UTSW	5	3630038	missense	probably damaging	1.00
R2054:Pex1	UTSW	5	3603341	missense	possibly damaging	0.78
R2081:Pex1	UTSW	5	3624132	critical splice donor site	probably null
R2237:Pex1	UTSW	5	3618915	critical splice donor site	probably null
R3946:Pex1	UTSW	5	3626084	missense	probably damaging	1.00
R4528:Pex1	UTSW	5	3631712	missense	probably damaging	1.00
R4579:Pex1	UTSW	5	3618880	missense	probably benign	0.03
R4585:Pex1	UTSW	5	3633885	missense	probably damaging	1.00
R4586:Pex1	UTSW	5	3633885	missense	probably damaging	1.00
R4656:Pex1	UTSW	5	3604880	critical splice donor site	probably null
R4789:Pex1	UTSW	5	3630270	missense	probably damaging	0.98
R4850:Pex1	UTSW	5	3624426	missense	probably benign
R4963:Pex1	UTSW	5	3609924	missense	probably benign	0.01
R5005:Pex1	UTSW	5	3622310	missense	probably damaging	1.00
R5015:Pex1	UTSW	5	3620597	missense	probably damaging	1.00
R5019:Pex1	UTSW	5	3622331	missense	probably damaging	1.00
R5937:Pex1	UTSW	5	3624487	missense	possibly damaging	0.94
R5942:Pex1	UTSW	5	3610277	missense	probably benign	0.04
R5995:Pex1	UTSW	5	3607704	missense	possibly damaging	0.53
R6434:Pex1	UTSW	5	3630196	nonsense	probably null
R6552:Pex1	UTSW	5	3623953	missense	probably damaging	1.00
R6777:Pex1	UTSW	5	3622358	missense	probably benign	0.01
R6877:Pex1	UTSW	5	3635505	missense	probably benign	0.19
R6948:Pex1	UTSW	5	3605994	missense	probably benign	0.00
R7317:Pex1	UTSW	5	3618875	missense	probably damaging	1.00
R7408:Pex1	UTSW	5	3630222	missense	probably damaging	1.00
R8062:Pex1	UTSW	5	3605656	missense	probably benign
R8354:Pex1	UTSW	5	3631707	missense	probably damaging	1.00
R8366:Pex1	UTSW	5	3626007	missense	probably benign	0.00
R8482:Pex1	UTSW	5	3612923	missense	probably benign	0.00
R8673:Pex1	UTSW	5	3635886	missense	possibly damaging	0.65
R8812:Pex1	UTSW	5	3631614	missense	probably benign	0.00
X0019:Pex1	UTSW	5	3605653	missense	probably damaging	1.00
X0027:Pex1	UTSW	5	3630270	missense	probably damaging	0.98
Z1088:Pex1	UTSW	5	3606075	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TCACTGGATGCCATCTTGC -3'
(R):5'- AGTCCCGAGCATTCGTGAAG -3'

Sequencing Primer
(F):5'- GCCATCTTGCCGGCTCTAG -3'
(R):5'- ATTCGTGAAGGCCACCGTC -3'

Posted On

2019-11-12