Incidental Mutation 'R7658:Git2'
ID591337
Institutional Source Beutler Lab
Gene Symbol Git2
Ensembl Gene ENSMUSG00000041890
Gene NameG protein-coupled receptor kinase-interactor 2
Synonyms5830420E16Rik, Cool associated tyrosine phosphorylated-2, ARF GTPase activating protein 2, 9630056M03Rik, B230104M05Rik, 1500036H07Rik, Cat-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R7658 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114727407-114775517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 114766489 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 123 (R123H)
Ref Sequence ENSEMBL: ENSMUSP00000107803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043283] [ENSMUST00000086564] [ENSMUST00000112183] [ENSMUST00000112185] [ENSMUST00000131016] [ENSMUST00000131993] [ENSMUST00000155908] [ENSMUST00000178440]
Predicted Effect probably damaging
Transcript: ENSMUST00000043283
AA Change: R123H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039718
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 266 296 4.96e-10 SMART
GIT 330 360 1.27e-7 SMART
Pfam:GIT1_C 550 674 2.4e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000086564
AA Change: R123H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083754
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 266 296 4.96e-10 SMART
GIT 330 360 1.27e-7 SMART
Pfam:GIT_CC 414 478 3.7e-31 PFAM
low complexity region 555 570 N/A INTRINSIC
Pfam:GIT1_C 636 752 6.4e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112183
AA Change: R123H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107801
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 268 298 4.96e-10 SMART
GIT 332 362 1.27e-7 SMART
Pfam:GIT1_C 552 676 1e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112185
AA Change: R123H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107803
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 265 295 4.96e-10 SMART
GIT 329 359 1.27e-7 SMART
low complexity region 504 519 N/A INTRINSIC
Pfam:GIT1_C 579 703 3e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131016
AA Change: R118H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116722
Gene: ENSMUSG00000041890
AA Change: R118H

DomainStartEndE-ValueType
ArfGap 9 119 4.52e-41 SMART
ANK 127 156 2.55e2 SMART
ANK 161 190 1.21e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131993
AA Change: R12H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118812
Gene: ENSMUSG00000041890
AA Change: R12H

DomainStartEndE-ValueType
ANK 21 50 2.55e2 SMART
ANK 55 84 1.21e1 SMART
ANK 88 117 3.95e1 SMART
Pfam:GIT_SHD 156 186 7.9e-19 PFAM
Pfam:GIT_SHD 220 249 3.5e-17 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122302
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 96 2.04e-25 SMART
ANK 104 133 2.55e2 SMART
ANK 138 167 1.21e1 SMART
ANK 171 200 3.95e1 SMART
GIT 238 268 4.96e-10 SMART
GIT 302 332 1.27e-7 SMART
Pfam:GIT1_C 474 598 8.3e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178440
AA Change: R123H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136796
Gene: ENSMUSG00000041890
AA Change: R123H

DomainStartEndE-ValueType
ArfGap 1 124 1.42e-56 SMART
ANK 132 161 2.55e2 SMART
ANK 166 195 1.21e1 SMART
ANK 199 228 3.95e1 SMART
GIT 267 297 4.96e-10 SMART
GIT 331 361 1.27e-7 SMART
Pfam:GIT1_C 551 675 2.4e-64 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GIT protein family, which interact with G protein-coupled receptor kinases and possess ADP-ribosylation factor (ARF) GTPase-activating protein (GAP) activity. GIT proteins traffic between cytoplasmic complexes, focal adhesions, and the cell periphery, and interact with Pak interacting exchange factor beta (PIX) to form large oligomeric complexes that transiently recruit other proteins. GIT proteins regulate cytoskeletal dynamics and participate in receptor internalization and membrane trafficking. This gene has been shown to repress lamellipodial extension and focal adhesion turnover, and is thought to regulate cell motility. This gene undergoes extensive alternative splicing to generate multiple isoforms, but the full-length nature of some of these variants has not been determined. The various isoforms have functional differences, with respect to ARF GAP activity and to G protein-coupled receptor kinase 2 binding. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a null allele show frequent splenomegaly, extramedullary hematopoiesis, impaired neutrophil chemotaxis, misoriented hyperproduction of superoxide anions and increased susceptibility to fungal infection. Homozygotes for a gene trap allele have reduced marginal zone B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 89,063,730 S72Y unknown Het
6430531B16Rik T C 7: 139,976,618 N152S probably benign Het
Abca8b T A 11: 109,935,717 K1568N probably benign Het
Adcy6 T A 15: 98,596,067 Y865F probably benign Het
Adgrf3 A T 5: 30,197,206 V608D probably benign Het
Agbl1 G T 7: 76,766,369 A965S unknown Het
Agbl3 C T 6: 34,832,508 P690L probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amt A C 9: 108,297,231 H65P probably damaging Het
Ankrd11 T A 8: 122,893,664 T1150S probably benign Het
Arhgap15 A C 2: 44,142,268 H288P probably benign Het
Arhgap39 A T 15: 76,737,417 M328K probably benign Het
Arhgef12 T C 9: 42,992,536 K743R probably damaging Het
Atg2a T G 19: 6,251,263 V789G probably damaging Het
Ccdc54 T C 16: 50,590,481 T141A probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh5 T C 8: 104,129,401 probably null Het
Cdkl3 T C 11: 52,027,182 V404A not run Het
Chrm2 A T 6: 36,523,249 I14F probably benign Het
Cnbp T C 6: 87,845,276 K89E possibly damaging Het
Cntn6 T A 6: 104,650,483 D92E probably benign Het
Col15a1 T C 4: 47,245,591 F114S possibly damaging Het
Csrnp1 A G 9: 119,972,403 F530S probably benign Het
Dcun1d3 C T 7: 119,857,668 V274M probably damaging Het
Dph2 T A 4: 117,890,281 H302L possibly damaging Het
Fam162a A T 16: 36,046,400 Y118* probably null Het
Fam186a A G 15: 99,939,844 Y2840H unknown Het
Fto A G 8: 91,666,322 K466E probably benign Het
Gal T A 19: 3,413,309 Y41F probably damaging Het
Gigyf2 A T 1: 87,419,138 L620F unknown Het
Glud1 A T 14: 34,311,157 E87V probably benign Het
Gm21190 T G 5: 15,527,925 E94A possibly damaging Het
Gm5592 T C 7: 41,288,710 V472A probably benign Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gpn2 A G 4: 133,591,376 E304G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Gucy2e G A 11: 69,226,229 Q789* probably null Het
Gxylt2 T A 6: 100,783,143 V213E probably damaging Het
Ighv1-75 G A 12: 115,834,111 L64F possibly damaging Het
Il17re T C 6: 113,458,982 C30R probably benign Het
Il7 G T 3: 7,604,082 D31E probably benign Het
Ints4 T C 7: 97,529,253 Y687H possibly damaging Het
Kdelr1 T G 7: 45,882,977 V202G probably benign Het
Khnyn C A 14: 55,887,139 Y283* probably null Het
Klf11 T C 12: 24,653,671 V52A probably damaging Het
Klhl7 A G 5: 24,141,286 N310S probably benign Het
Krt27 A T 11: 99,349,486 L202Q possibly damaging Het
Lce1d A G 3: 92,686,047 C20R unknown Het
Lim2 A T 7: 43,433,630 I80F possibly damaging Het
Lrrk2 T A 15: 91,700,358 F326Y possibly damaging Het
Lyst A T 13: 13,730,476 Y3246F possibly damaging Het
Mafb T A 2: 160,366,435 H81L possibly damaging Het
Mfsd5 G A 15: 102,280,877 R228H probably benign Het
Mmp1b A T 9: 7,386,675 F150I possibly damaging Het
Mthfd1 T A 12: 76,270,435 L20Q probably damaging Het
Mxra8 A G 4: 155,842,963 T402A probably benign Het
Ndc80 A T 17: 71,508,663 L376M probably damaging Het
Nsd1 A T 13: 55,277,639 R1536S probably damaging Het
Nup210l C A 3: 90,211,993 H1874Q probably benign Het
Nyap1 T C 5: 137,732,974 H776R probably benign Het
Patj C A 4: 98,688,179 H1773Q probably damaging Het
Pax8 T A 2: 24,436,511 T280S probably benign Het
Pcdhb19 A G 18: 37,498,981 T610A probably damaging Het
Pde2a A G 7: 101,511,581 D919G possibly damaging Het
Pdk2 T A 11: 95,028,965 Y240F probably damaging Het
Peg3 A T 7: 6,709,610 I871N probably damaging Het
Pex1 A T 5: 3,596,244 probably benign Het
Pgm2l1 C T 7: 100,250,328 R50W probably damaging Het
Phkg1 T A 5: 129,865,923 K262N probably damaging Het
Pik3r4 A G 9: 105,644,511 E92G probably damaging Het
Prmt6 A T 3: 110,250,385 V196E possibly damaging Het
Ptprn2 T G 12: 116,722,119 M66R probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Recql5 A T 11: 115,923,276 S348T probably damaging Het
Rfk T G 19: 17,398,682 probably null Het
Selenbp1 A T 3: 94,944,102 M389L probably benign Het
Sipa1l2 G A 8: 125,492,290 R103C probably benign Het
Slc10a6 T A 5: 103,629,190 S15C probably damaging Het
Slc12a2 G T 18: 57,932,524 V944L probably benign Het
Slc16a11 T A 11: 70,215,317 L127Q possibly damaging Het
St6gal1 A G 16: 23,356,228 Y272C probably damaging Het
Stab2 C A 10: 86,981,135 V133F probably benign Het
Stradb G A 1: 58,992,726 V266I probably damaging Het
Tmem150b A G 7: 4,720,759 W140R probably benign Het
Tnnt3 A T 7: 142,512,096 K157* probably null Het
Trove2 T C 1: 143,770,873 T45A probably damaging Het
Ttn T G 2: 76,723,769 K30863N probably damaging Het
Vldlr G A 19: 27,243,136 R592H probably benign Het
Vmn1r12 A T 6: 57,158,898 probably benign Het
Vmn2r63 A C 7: 42,925,269 S519R probably damaging Het
Zbtb22 G C 17: 33,918,497 E539Q probably damaging Het
Zbtb44 G A 9: 31,054,079 A262T probably benign Het
Zfp280d A T 9: 72,324,072 N455I probably damaging Het
Zfp287 T C 11: 62,725,263 N201D probably damaging Het
Zfp988 T C 4: 147,332,294 L395P probably damaging Het
Other mutations in Git2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Git2 APN 5 114767105 missense probably damaging 1.00
IGL02538:Git2 APN 5 114730986 splice site probably benign
IGL03114:Git2 APN 5 114733857 splice site probably benign
IGL03278:Git2 APN 5 114745579 splice site probably benign
IGL03278:Git2 APN 5 114745580 splice site probably null
ponto UTSW 5 114739101 missense probably damaging 1.00
vecchio UTSW 5 114769698 nonsense probably null
R0184:Git2 UTSW 5 114739037 missense possibly damaging 0.47
R0241:Git2 UTSW 5 114733229 missense probably damaging 1.00
R0241:Git2 UTSW 5 114733229 missense probably damaging 1.00
R0540:Git2 UTSW 5 114748274 missense probably damaging 1.00
R0543:Git2 UTSW 5 114745531 missense probably damaging 0.97
R0612:Git2 UTSW 5 114752281 missense probably damaging 1.00
R1144:Git2 UTSW 5 114753314 missense probably benign 0.27
R1225:Git2 UTSW 5 114733178 splice site probably benign
R1783:Git2 UTSW 5 114739124 missense probably damaging 1.00
R1923:Git2 UTSW 5 114739101 missense probably damaging 1.00
R1956:Git2 UTSW 5 114749337 nonsense probably null
R1981:Git2 UTSW 5 114749559 splice site probably benign
R2029:Git2 UTSW 5 114766450 critical splice donor site probably null
R3150:Git2 UTSW 5 114730349 missense probably damaging 1.00
R4087:Git2 UTSW 5 114764405 missense probably damaging 0.99
R4367:Git2 UTSW 5 114764666 missense probably damaging 1.00
R4400:Git2 UTSW 5 114733909 missense possibly damaging 0.94
R4702:Git2 UTSW 5 114745482 missense probably damaging 1.00
R4758:Git2 UTSW 5 114730351 missense probably damaging 1.00
R4840:Git2 UTSW 5 114745482 missense probably damaging 1.00
R5236:Git2 UTSW 5 114767172 missense probably damaging 1.00
R5427:Git2 UTSW 5 114730328 missense possibly damaging 0.82
R5510:Git2 UTSW 5 114743774 critical splice donor site probably null
R6014:Git2 UTSW 5 114733877 missense probably benign 0.32
R6162:Git2 UTSW 5 114761656 missense probably damaging 0.99
R6195:Git2 UTSW 5 114767114 missense probably benign 0.27
R6198:Git2 UTSW 5 114745495 nonsense probably null
R6233:Git2 UTSW 5 114767114 missense probably benign 0.27
R6277:Git2 UTSW 5 114733247 missense probably damaging 1.00
R6603:Git2 UTSW 5 114730991 critical splice donor site probably null
R7141:Git2 UTSW 5 114769698 nonsense probably null
R7420:Git2 UTSW 5 114730370 missense probably benign 0.00
R7468:Git2 UTSW 5 114733897 missense probably damaging 1.00
R7574:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7575:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7577:Git2 UTSW 5 114766489 missense probably damaging 1.00
R7651:Git2 UTSW 5 114733235 missense probably damaging 1.00
R7893:Git2 UTSW 5 114769676 missense possibly damaging 0.83
R8067:Git2 UTSW 5 114766518 missense probably damaging 0.99
R8415:Git2 UTSW 5 114733928 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCCAGTGTGTCTGAGAGGAG -3'
(R):5'- TTGACTCTGCTGCAGTGGAG -3'

Sequencing Primer
(F):5'- CCAGTGTGTCTGAGAGGAGTGAATG -3'
(R):5'- TTGTTTCCAAACCAGCC -3'
Posted On2019-11-12