Incidental Mutation 'R7658:Agbl1'
ID 591353
Institutional Source Beutler Lab
Gene Symbol Agbl1
Ensembl Gene ENSMUSG00000025754
Gene Name ATP/GTP binding protein-like 1
Synonyms Nna1-l1, Ccp4, EG244071
MMRRC Submission 045703-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7658 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 75879635-76774446 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76416117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 965 (A965S)
Ref Sequence ENSEMBL: ENSMUSP00000119721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107442] [ENSMUST00000156166]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000107442
AA Change: A713S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103066
Gene: ENSMUSG00000025754
AA Change: A713S

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Pfam:Peptidase_M14 494 754 3.1e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156166
AA Change: A965S
SMART Domains Protein: ENSMUSP00000119721
Gene: ENSMUSG00000025754
AA Change: A965S

DomainStartEndE-ValueType
low complexity region 254 270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyglutamylation is a reversible posttranslational modification catalyzed by polyglutamylases that results in the addition of glutamate side chains on the modified protein. This gene encodes a glutamate decarboxylase that catalyzes the deglutamylation of polyglutamylated proteins. Mutations in this gene result in dominant late-onset Fuchs corneal dystrophy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 88,860,618 (GRCm39) S72Y unknown Het
Abca8b T A 11: 109,826,543 (GRCm39) K1568N probably benign Het
Adcy6 T A 15: 98,493,948 (GRCm39) Y865F probably benign Het
Adgrf3 A T 5: 30,402,204 (GRCm39) V608D probably benign Het
Agbl3 C T 6: 34,809,443 (GRCm39) P690L probably benign Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Amt A C 9: 108,174,430 (GRCm39) H65P probably damaging Het
Ankrd11 T A 8: 123,620,403 (GRCm39) T1150S probably benign Het
Arhgap15 A C 2: 44,032,280 (GRCm39) H288P probably benign Het
Arhgap39 A T 15: 76,621,617 (GRCm39) M328K probably benign Het
Arhgef12 T C 9: 42,903,832 (GRCm39) K743R probably damaging Het
Atg2a T G 19: 6,301,293 (GRCm39) V789G probably damaging Het
Ccdc54 T C 16: 50,410,844 (GRCm39) T141A probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cdh5 T C 8: 104,856,033 (GRCm39) probably null Het
Cdkl3 T C 11: 51,918,009 (GRCm39) V404A not run Het
Chrm2 A T 6: 36,500,184 (GRCm39) I14F probably benign Het
Cnbp T C 6: 87,822,258 (GRCm39) K89E possibly damaging Het
Cntn6 T A 6: 104,627,444 (GRCm39) D92E probably benign Het
Col15a1 T C 4: 47,245,591 (GRCm39) F114S possibly damaging Het
Csrnp1 A G 9: 119,801,469 (GRCm39) F530S probably benign Het
Dcun1d3 C T 7: 119,456,891 (GRCm39) V274M probably damaging Het
Dph2 T A 4: 117,747,478 (GRCm39) H302L possibly damaging Het
Fam162a A T 16: 35,866,770 (GRCm39) Y118* probably null Het
Fam186a A G 15: 99,837,725 (GRCm39) Y2840H unknown Het
Fto A G 8: 92,392,950 (GRCm39) K466E probably benign Het
Gal T A 19: 3,463,309 (GRCm39) Y41F probably damaging Het
Gigyf2 A T 1: 87,346,860 (GRCm39) L620F unknown Het
Git2 C T 5: 114,904,550 (GRCm39) R123H probably damaging Het
Glud1 A T 14: 34,033,114 (GRCm39) E87V probably benign Het
Gm21190 T G 5: 15,732,923 (GRCm39) E94A possibly damaging Het
Gm5592 T C 7: 40,938,134 (GRCm39) V472A probably benign Het
Gpc5 T A 14: 115,665,620 (GRCm39) N481K possibly damaging Het
Gpn2 A G 4: 133,318,687 (GRCm39) E304G probably benign Het
Gsdmc2 T C 15: 63,696,903 (GRCm39) T423A probably damaging Het
Gucy2e G A 11: 69,117,055 (GRCm39) Q789* probably null Het
Gxylt2 T A 6: 100,760,104 (GRCm39) V213E probably damaging Het
Ighv1-75 G A 12: 115,797,731 (GRCm39) L64F possibly damaging Het
Il17re T C 6: 113,435,943 (GRCm39) C30R probably benign Het
Il7 G T 3: 7,669,142 (GRCm39) D31E probably benign Het
Ints4 T C 7: 97,178,460 (GRCm39) Y687H possibly damaging Het
Kdelr1 T G 7: 45,532,401 (GRCm39) V202G probably benign Het
Khnyn C A 14: 56,124,596 (GRCm39) Y283* probably null Het
Klf11 T C 12: 24,703,670 (GRCm39) V52A probably damaging Het
Klhl7 A G 5: 24,346,284 (GRCm39) N310S probably benign Het
Krt27 A T 11: 99,240,312 (GRCm39) L202Q possibly damaging Het
Lce1d A G 3: 92,593,354 (GRCm39) C20R unknown Het
Lim2 A T 7: 43,083,054 (GRCm39) I80F possibly damaging Het
Lrrk2 T A 15: 91,584,561 (GRCm39) F326Y possibly damaging Het
Lyst A T 13: 13,905,061 (GRCm39) Y3246F possibly damaging Het
Mafb T A 2: 160,208,355 (GRCm39) H81L possibly damaging Het
Mfsd5 G A 15: 102,189,312 (GRCm39) R228H probably benign Het
Mmp1b A T 9: 7,386,675 (GRCm39) F150I possibly damaging Het
Mthfd1 T A 12: 76,317,209 (GRCm39) L20Q probably damaging Het
Mxra8 A G 4: 155,927,420 (GRCm39) T402A probably benign Het
Ndc80 A T 17: 71,815,658 (GRCm39) L376M probably damaging Het
Nsd1 A T 13: 55,425,452 (GRCm39) R1536S probably damaging Het
Nup210l C A 3: 90,119,300 (GRCm39) H1874Q probably benign Het
Nyap1 T C 5: 137,731,236 (GRCm39) H776R probably benign Het
Patj C A 4: 98,576,416 (GRCm39) H1773Q probably damaging Het
Pax8 T A 2: 24,326,523 (GRCm39) T280S probably benign Het
Pcdhb19 A G 18: 37,632,034 (GRCm39) T610A probably damaging Het
Pde2a A G 7: 101,160,788 (GRCm39) D919G possibly damaging Het
Pdk2 T A 11: 94,919,791 (GRCm39) Y240F probably damaging Het
Peg3 A T 7: 6,712,609 (GRCm39) I871N probably damaging Het
Pex1 A T 5: 3,646,244 (GRCm39) probably benign Het
Pgm2l1 C T 7: 99,899,535 (GRCm39) R50W probably damaging Het
Phkg1 T A 5: 129,894,764 (GRCm39) K262N probably damaging Het
Pik3r4 A G 9: 105,521,710 (GRCm39) E92G probably damaging Het
Prmt6 A T 3: 110,157,701 (GRCm39) V196E possibly damaging Het
Ptprn2 T G 12: 116,685,739 (GRCm39) M66R probably benign Het
Rai14 C T 15: 10,593,189 (GRCm39) G152R probably damaging Het
Recql5 A T 11: 115,814,102 (GRCm39) S348T probably damaging Het
Rfk T G 19: 17,376,046 (GRCm39) probably null Het
Ro60 T C 1: 143,646,611 (GRCm39) T45A probably damaging Het
Selenbp1 A T 3: 94,851,413 (GRCm39) M389L probably benign Het
Sipa1l2 G A 8: 126,219,029 (GRCm39) R103C probably benign Het
Slc10a6 T A 5: 103,777,056 (GRCm39) S15C probably damaging Het
Slc12a2 G T 18: 58,065,596 (GRCm39) V944L probably benign Het
Slc16a11 T A 11: 70,106,143 (GRCm39) L127Q possibly damaging Het
Spef1l T C 7: 139,556,531 (GRCm39) N152S probably benign Het
St6gal1 A G 16: 23,174,978 (GRCm39) Y272C probably damaging Het
Stab2 C A 10: 86,816,999 (GRCm39) V133F probably benign Het
Stradb G A 1: 59,031,885 (GRCm39) V266I probably damaging Het
Tmem150b A G 7: 4,723,758 (GRCm39) W140R probably benign Het
Tnnt3 A T 7: 142,065,833 (GRCm39) K157* probably null Het
Ttn T G 2: 76,554,113 (GRCm39) K30863N probably damaging Het
Vldlr G A 19: 27,220,536 (GRCm39) R592H probably benign Het
Vmn1r12 A T 6: 57,135,883 (GRCm39) probably benign Het
Vmn2r63 A C 7: 42,574,693 (GRCm39) S519R probably damaging Het
Zbtb22 G C 17: 34,137,471 (GRCm39) E539Q probably damaging Het
Zbtb44 G A 9: 30,965,375 (GRCm39) A262T probably benign Het
Zfp280d A T 9: 72,231,354 (GRCm39) N455I probably damaging Het
Zfp287 T C 11: 62,616,089 (GRCm39) N201D probably damaging Het
Zfp988 T C 4: 147,416,751 (GRCm39) L395P probably damaging Het
Other mutations in Agbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Agbl1 APN 7 76,071,628 (GRCm39) missense probably benign 0.01
IGL01650:Agbl1 APN 7 76,070,067 (GRCm39) missense probably damaging 1.00
IGL02244:Agbl1 APN 7 76,416,120 (GRCm39) missense probably damaging 1.00
IGL03088:Agbl1 APN 7 76,369,890 (GRCm39) missense probably benign 0.12
IGL03143:Agbl1 APN 7 76,069,793 (GRCm39) nonsense probably null
IGL03306:Agbl1 APN 7 76,239,252 (GRCm39) missense probably damaging 1.00
R0001:Agbl1 UTSW 7 76,069,611 (GRCm39) missense probably damaging 0.98
R0045:Agbl1 UTSW 7 76,348,588 (GRCm39) critical splice donor site probably null
R0045:Agbl1 UTSW 7 76,348,588 (GRCm39) critical splice donor site probably null
R0541:Agbl1 UTSW 7 76,058,993 (GRCm39) missense probably benign 0.22
R1889:Agbl1 UTSW 7 76,239,129 (GRCm39) missense probably damaging 1.00
R2089:Agbl1 UTSW 7 76,239,248 (GRCm39) missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76,239,248 (GRCm39) missense probably damaging 0.98
R2091:Agbl1 UTSW 7 76,239,248 (GRCm39) missense probably damaging 0.98
R2127:Agbl1 UTSW 7 76,069,628 (GRCm39) missense possibly damaging 0.64
R2148:Agbl1 UTSW 7 76,064,465 (GRCm39) splice site probably null
R2229:Agbl1 UTSW 7 76,083,126 (GRCm39) missense probably benign 0.43
R2243:Agbl1 UTSW 7 76,068,470 (GRCm39) missense possibly damaging 0.93
R2255:Agbl1 UTSW 7 76,071,932 (GRCm39) missense probably damaging 1.00
R2411:Agbl1 UTSW 7 76,369,898 (GRCm39) missense probably damaging 1.00
R2426:Agbl1 UTSW 7 76,071,650 (GRCm39) missense probably damaging 1.00
R2508:Agbl1 UTSW 7 76,239,298 (GRCm39) critical splice donor site probably null
R2910:Agbl1 UTSW 7 76,069,586 (GRCm39) missense probably benign 0.13
R2919:Agbl1 UTSW 7 76,064,406 (GRCm39) missense probably damaging 1.00
R3056:Agbl1 UTSW 7 76,416,232 (GRCm39) missense possibly damaging 0.60
R3153:Agbl1 UTSW 7 76,369,944 (GRCm39) missense probably damaging 1.00
R3770:Agbl1 UTSW 7 76,075,677 (GRCm39) critical splice donor site probably null
R3825:Agbl1 UTSW 7 76,069,715 (GRCm39) missense probably damaging 0.99
R4632:Agbl1 UTSW 7 76,063,433 (GRCm39) missense probably benign 0.00
R4857:Agbl1 UTSW 7 76,069,583 (GRCm39) missense probably benign 0.03
R4943:Agbl1 UTSW 7 76,069,764 (GRCm39) missense probably benign 0.01
R5055:Agbl1 UTSW 7 76,063,325 (GRCm39) missense probably damaging 1.00
R5071:Agbl1 UTSW 7 76,071,665 (GRCm39) missense probably damaging 1.00
R5072:Agbl1 UTSW 7 76,071,665 (GRCm39) missense probably damaging 1.00
R5074:Agbl1 UTSW 7 76,071,665 (GRCm39) missense probably damaging 1.00
R5095:Agbl1 UTSW 7 76,369,881 (GRCm39) missense probably damaging 0.96
R5133:Agbl1 UTSW 7 76,071,904 (GRCm39) missense probably benign 0.21
R5576:Agbl1 UTSW 7 75,984,985 (GRCm39) missense probably benign 0.03
R5665:Agbl1 UTSW 7 76,239,251 (GRCm39) missense probably damaging 1.00
R5849:Agbl1 UTSW 7 75,974,846 (GRCm39) missense probably benign 0.35
R5924:Agbl1 UTSW 7 76,058,982 (GRCm39) missense probably benign 0.12
R6044:Agbl1 UTSW 7 75,967,868 (GRCm39) missense possibly damaging 0.56
R6117:Agbl1 UTSW 7 76,348,534 (GRCm39) missense probably damaging 1.00
R6144:Agbl1 UTSW 7 76,069,832 (GRCm39) missense probably benign 0.02
R6368:Agbl1 UTSW 7 76,069,578 (GRCm39) missense probably benign 0.25
R6806:Agbl1 UTSW 7 76,075,669 (GRCm39) missense probably damaging 1.00
R7455:Agbl1 UTSW 7 76,074,503 (GRCm39) missense unknown
R7459:Agbl1 UTSW 7 76,069,814 (GRCm39) missense not run
R7485:Agbl1 UTSW 7 76,239,241 (GRCm39) missense unknown
R7516:Agbl1 UTSW 7 76,075,669 (GRCm39) missense probably damaging 1.00
R7539:Agbl1 UTSW 7 76,075,677 (GRCm39) critical splice donor site probably null
R7561:Agbl1 UTSW 7 76,348,509 (GRCm39) missense unknown
R7630:Agbl1 UTSW 7 76,535,904 (GRCm39) missense unknown
R7655:Agbl1 UTSW 7 76,059,080 (GRCm39) missense
R7656:Agbl1 UTSW 7 76,059,080 (GRCm39) missense
R7681:Agbl1 UTSW 7 76,094,649 (GRCm39) missense unknown
R7694:Agbl1 UTSW 7 76,348,513 (GRCm39) missense unknown
R7773:Agbl1 UTSW 7 76,348,585 (GRCm39) missense unknown
R7981:Agbl1 UTSW 7 76,094,588 (GRCm39) missense unknown
R8208:Agbl1 UTSW 7 76,369,916 (GRCm39) missense unknown
R8317:Agbl1 UTSW 7 76,071,929 (GRCm39) missense unknown
R8406:Agbl1 UTSW 7 76,068,415 (GRCm39) missense
R8432:Agbl1 UTSW 7 76,774,434 (GRCm39) missense unknown
R8704:Agbl1 UTSW 7 76,239,302 (GRCm39) splice site probably benign
R8830:Agbl1 UTSW 7 75,985,059 (GRCm39) missense
R8985:Agbl1 UTSW 7 75,969,904 (GRCm39) missense
R9113:Agbl1 UTSW 7 76,239,225 (GRCm39) missense unknown
R9170:Agbl1 UTSW 7 75,985,069 (GRCm39) missense
R9229:Agbl1 UTSW 7 76,774,270 (GRCm39) missense unknown
R9255:Agbl1 UTSW 7 76,416,150 (GRCm39) missense unknown
R9391:Agbl1 UTSW 7 76,071,602 (GRCm39) missense unknown
R9646:Agbl1 UTSW 7 76,075,648 (GRCm39) missense unknown
Z1088:Agbl1 UTSW 7 76,069,652 (GRCm39) missense probably benign 0.00
Z1176:Agbl1 UTSW 7 76,068,433 (GRCm39) missense
Z1177:Agbl1 UTSW 7 76,369,954 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GGGATTCAGAGTAACATAACATGTG -3'
(R):5'- TTTCACAGCAAAGGAGTGAGGC -3'

Sequencing Primer
(F):5'- TCAGAGTAACATAACATGTGGTTTG -3'
(R):5'- TGAGGCAGGACTCAGCTTG -3'
Posted On 2019-11-12