Incidental Mutation 'R7658:Pde2a'
ID591356
Institutional Source Beutler Lab
Gene Symbol Pde2a
Ensembl Gene ENSMUSG00000110195
Gene Namephosphodiesterase 2A, cGMP-stimulated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.802) question?
Stock #R7658 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location101421691-101512827 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101511581 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 919 (D919G)
Ref Sequence ENSEMBL: ENSMUSP00000147553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084894] [ENSMUST00000163751] [ENSMUST00000166652] [ENSMUST00000209537] [ENSMUST00000210364] [ENSMUST00000211368]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084894
AA Change: D935G

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081956
Gene: ENSMUSG00000030653
AA Change: D935G

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163751
AA Change: D913G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131553
Gene: ENSMUSG00000110195
AA Change: D913G

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 386 2.22e-17 SMART
GAF 408 557 6.11e-38 SMART
HDc 652 821 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000166652
AA Change: D909G

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127521
Gene: ENSMUSG00000110195
AA Change: D909G

DomainStartEndE-ValueType
Blast:GAF 57 181 4e-76 BLAST
low complexity region 182 196 N/A INTRINSIC
GAF 235 382 2.2e-21 SMART
GAF 404 553 6.11e-38 SMART
HDc 648 817 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000209537
AA Change: D919G

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000210364
Predicted Effect possibly damaging
Transcript: ENSMUST00000211368
AA Change: D909G

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between E17 and E18; another knock out mutation results in only some animals surviving to weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 89,063,730 S72Y unknown Het
6430531B16Rik T C 7: 139,976,618 N152S probably benign Het
Abca8b T A 11: 109,935,717 K1568N probably benign Het
Adcy6 T A 15: 98,596,067 Y865F probably benign Het
Adgrf3 A T 5: 30,197,206 V608D probably benign Het
Agbl1 G T 7: 76,766,369 A965S unknown Het
Agbl3 C T 6: 34,832,508 P690L probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amt A C 9: 108,297,231 H65P probably damaging Het
Ankrd11 T A 8: 122,893,664 T1150S probably benign Het
Arhgap15 A C 2: 44,142,268 H288P probably benign Het
Arhgap39 A T 15: 76,737,417 M328K probably benign Het
Arhgef12 T C 9: 42,992,536 K743R probably damaging Het
Atg2a T G 19: 6,251,263 V789G probably damaging Het
Ccdc54 T C 16: 50,590,481 T141A probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh5 T C 8: 104,129,401 probably null Het
Cdkl3 T C 11: 52,027,182 V404A not run Het
Chrm2 A T 6: 36,523,249 I14F probably benign Het
Cnbp T C 6: 87,845,276 K89E possibly damaging Het
Cntn6 T A 6: 104,650,483 D92E probably benign Het
Col15a1 T C 4: 47,245,591 F114S possibly damaging Het
Csrnp1 A G 9: 119,972,403 F530S probably benign Het
Dcun1d3 C T 7: 119,857,668 V274M probably damaging Het
Dph2 T A 4: 117,890,281 H302L possibly damaging Het
Fam162a A T 16: 36,046,400 Y118* probably null Het
Fam186a A G 15: 99,939,844 Y2840H unknown Het
Fto A G 8: 91,666,322 K466E probably benign Het
Gal T A 19: 3,413,309 Y41F probably damaging Het
Gigyf2 A T 1: 87,419,138 L620F unknown Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Glud1 A T 14: 34,311,157 E87V probably benign Het
Gm21190 T G 5: 15,527,925 E94A possibly damaging Het
Gm5592 T C 7: 41,288,710 V472A probably benign Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gpn2 A G 4: 133,591,376 E304G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Gucy2e G A 11: 69,226,229 Q789* probably null Het
Gxylt2 T A 6: 100,783,143 V213E probably damaging Het
Ighv1-75 G A 12: 115,834,111 L64F possibly damaging Het
Il17re T C 6: 113,458,982 C30R probably benign Het
Il7 G T 3: 7,604,082 D31E probably benign Het
Ints4 T C 7: 97,529,253 Y687H possibly damaging Het
Kdelr1 T G 7: 45,882,977 V202G probably benign Het
Khnyn C A 14: 55,887,139 Y283* probably null Het
Klf11 T C 12: 24,653,671 V52A probably damaging Het
Klhl7 A G 5: 24,141,286 N310S probably benign Het
Krt27 A T 11: 99,349,486 L202Q possibly damaging Het
Lce1d A G 3: 92,686,047 C20R unknown Het
Lim2 A T 7: 43,433,630 I80F possibly damaging Het
Lrrk2 T A 15: 91,700,358 F326Y possibly damaging Het
Lyst A T 13: 13,730,476 Y3246F possibly damaging Het
Mafb T A 2: 160,366,435 H81L possibly damaging Het
Mfsd5 G A 15: 102,280,877 R228H probably benign Het
Mmp1b A T 9: 7,386,675 F150I possibly damaging Het
Mthfd1 T A 12: 76,270,435 L20Q probably damaging Het
Mxra8 A G 4: 155,842,963 T402A probably benign Het
Ndc80 A T 17: 71,508,663 L376M probably damaging Het
Nsd1 A T 13: 55,277,639 R1536S probably damaging Het
Nup210l C A 3: 90,211,993 H1874Q probably benign Het
Nyap1 T C 5: 137,732,974 H776R probably benign Het
Patj C A 4: 98,688,179 H1773Q probably damaging Het
Pax8 T A 2: 24,436,511 T280S probably benign Het
Pcdhb19 A G 18: 37,498,981 T610A probably damaging Het
Pdk2 T A 11: 95,028,965 Y240F probably damaging Het
Peg3 A T 7: 6,709,610 I871N probably damaging Het
Pex1 A T 5: 3,596,244 probably benign Het
Pgm2l1 C T 7: 100,250,328 R50W probably damaging Het
Phkg1 T A 5: 129,865,923 K262N probably damaging Het
Pik3r4 A G 9: 105,644,511 E92G probably damaging Het
Prmt6 A T 3: 110,250,385 V196E possibly damaging Het
Ptprn2 T G 12: 116,722,119 M66R probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Recql5 A T 11: 115,923,276 S348T probably damaging Het
Rfk T G 19: 17,398,682 probably null Het
Selenbp1 A T 3: 94,944,102 M389L probably benign Het
Sipa1l2 G A 8: 125,492,290 R103C probably benign Het
Slc10a6 T A 5: 103,629,190 S15C probably damaging Het
Slc12a2 G T 18: 57,932,524 V944L probably benign Het
Slc16a11 T A 11: 70,215,317 L127Q possibly damaging Het
St6gal1 A G 16: 23,356,228 Y272C probably damaging Het
Stab2 C A 10: 86,981,135 V133F probably benign Het
Stradb G A 1: 58,992,726 V266I probably damaging Het
Tmem150b A G 7: 4,720,759 W140R probably benign Het
Tnnt3 A T 7: 142,512,096 K157* probably null Het
Trove2 T C 1: 143,770,873 T45A probably damaging Het
Ttn T G 2: 76,723,769 K30863N probably damaging Het
Vldlr G A 19: 27,243,136 R592H probably benign Het
Vmn1r12 A T 6: 57,158,898 probably benign Het
Vmn2r63 A C 7: 42,925,269 S519R probably damaging Het
Zbtb22 G C 17: 33,918,497 E539Q probably damaging Het
Zbtb44 G A 9: 31,054,079 A262T probably benign Het
Zfp280d A T 9: 72,324,072 N455I probably damaging Het
Zfp287 T C 11: 62,725,263 N201D probably damaging Het
Zfp988 T C 4: 147,332,294 L395P probably damaging Het
Other mutations in Pde2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Pde2a APN 7 101484589 nonsense probably null
IGL00731:Pde2a APN 7 101508099 missense probably benign 0.04
IGL00807:Pde2a APN 7 101504412 missense probably damaging 1.00
IGL01339:Pde2a APN 7 101507159 missense probably benign
IGL01503:Pde2a APN 7 101501936 splice site probably benign
IGL01646:Pde2a APN 7 101507711 missense possibly damaging 0.95
IGL01960:Pde2a APN 7 101504740 missense probably benign 0.40
IGL02281:Pde2a APN 7 101481392 missense probably benign 0.34
IGL02318:Pde2a APN 7 101503343 missense possibly damaging 0.79
IGL02479:Pde2a APN 7 101501083 missense probably damaging 1.00
IGL02632:Pde2a APN 7 101504656 missense probably damaging 1.00
IGL02725:Pde2a APN 7 101507218 missense probably null 0.00
IGL02888:Pde2a APN 7 101505069 missense probably damaging 0.98
IGL03027:Pde2a APN 7 101481420 missense probably benign 0.01
IGL03114:Pde2a APN 7 101508683 splice site probably benign
PIT1430001:Pde2a UTSW 7 101451477 splice site probably benign
PIT4131001:Pde2a UTSW 7 101511154 missense probably damaging 0.98
PIT4431001:Pde2a UTSW 7 101501897 missense probably damaging 1.00
R1170:Pde2a UTSW 7 101484543 missense probably benign 0.00
R1298:Pde2a UTSW 7 101507202 missense probably benign 0.12
R1300:Pde2a UTSW 7 101510404 missense possibly damaging 0.48
R1451:Pde2a UTSW 7 101421991 nonsense probably null
R1731:Pde2a UTSW 7 101501660 missense probably damaging 1.00
R1863:Pde2a UTSW 7 101511154 missense probably damaging 1.00
R2258:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R2259:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R2260:Pde2a UTSW 7 101484567 missense probably damaging 1.00
R4179:Pde2a UTSW 7 101481383 makesense probably null
R4688:Pde2a UTSW 7 101502834 missense probably benign
R4717:Pde2a UTSW 7 101494672 missense probably benign 0.00
R4723:Pde2a UTSW 7 101494618 missense possibly damaging 0.80
R4758:Pde2a UTSW 7 101511499 missense probably damaging 1.00
R4965:Pde2a UTSW 7 101502933 missense probably benign 0.01
R5034:Pde2a UTSW 7 101502024 missense probably benign 0.01
R5219:Pde2a UTSW 7 101504604 missense probably damaging 1.00
R5533:Pde2a UTSW 7 101505980 missense probably damaging 0.97
R6083:Pde2a UTSW 7 101502879 missense possibly damaging 0.93
R6114:Pde2a UTSW 7 101511112 critical splice acceptor site probably null
R6365:Pde2a UTSW 7 101510363 missense probably damaging 1.00
R6372:Pde2a UTSW 7 101481392 missense probably benign 0.34
R6395:Pde2a UTSW 7 101501035 missense probably benign 0.00
R6482:Pde2a UTSW 7 101501037 missense probably benign 0.11
R6492:Pde2a UTSW 7 101500442 missense possibly damaging 0.71
R6971:Pde2a UTSW 7 101510313 nonsense probably null
R7027:Pde2a UTSW 7 101511597 missense probably damaging 1.00
R7082:Pde2a UTSW 7 101508096 missense probably damaging 1.00
R7107:Pde2a UTSW 7 101421968 missense probably benign 0.01
R7142:Pde2a UTSW 7 101504650 missense probably damaging 1.00
R7203:Pde2a UTSW 7 101509944 missense possibly damaging 0.70
R7231:Pde2a UTSW 7 101505953 missense probably damaging 0.99
R7248:Pde2a UTSW 7 101503390 missense possibly damaging 0.88
R7570:Pde2a UTSW 7 101502834 missense probably benign 0.03
R7632:Pde2a UTSW 7 101484594 missense possibly damaging 0.64
R8061:Pde2a UTSW 7 101503972 missense probably benign 0.29
R8098:Pde2a UTSW 7 101421971 missense probably benign
R8165:Pde2a UTSW 7 101500448 critical splice donor site probably null
R8297:Pde2a UTSW 7 101504673 missense possibly damaging 0.86
R8513:Pde2a UTSW 7 101509765 missense probably damaging 1.00
R8708:Pde2a UTSW 7 101510381 missense probably damaging 1.00
R8794:Pde2a UTSW 7 101505929 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTACTCTGTGCCAACCCCAG -3'
(R):5'- ATGGCTCTGGTTCCCAATG -3'

Sequencing Primer
(F):5'- CCAGGCTTCATATCCTTACAGAAGTG -3'
(R):5'- GCTCTGGTTCCCAATGCATCAAAC -3'
Posted On2019-11-12