Mutagenetix > Incidental Mutations

Incidental Mutation 'R7658:Ankrd11'

591362

Institutional Source

Beutler Lab

Gene Symbol

Ankrd11

Ensembl Gene

ENSMUSG00000035569

Gene Name

ankyrin repeat domain 11

Synonyms

3010027A04Rik, Yod, 2410104C19Rik, 9530048I21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

122883822-123042277 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 122893664 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1150 (T1150S)

Ref Sequence

ENSEMBL: ENSMUSP00000095938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098333] [ENSMUST00000098334] [ENSMUST00000127664] [ENSMUST00000172906]

Predicted Effect

probably benign
Transcript: ENSMUST00000098333
AA Change: T1150S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095938
Gene: ENSMUSG00000035569
AA Change: T1150S

Domain	Start	End	E-Value	Type
ANK	188	217	2.58e-3	SMART
ANK	221	250	1.31e-4	SMART
ANK	254	283	5.04e-6	SMART
low complexity region	311	324	N/A	INTRINSIC
low complexity region	366	377	N/A	INTRINSIC
low complexity region	429	440	N/A	INTRINSIC
low complexity region	470	487	N/A	INTRINSIC
low complexity region	499	521	N/A	INTRINSIC
low complexity region	534	549	N/A	INTRINSIC
low complexity region	596	609	N/A	INTRINSIC
low complexity region	649	669	N/A	INTRINSIC
coiled coil region	786	826	N/A	INTRINSIC
low complexity region	867	877	N/A	INTRINSIC
low complexity region	965	984	N/A	INTRINSIC
low complexity region	1040	1055	N/A	INTRINSIC
low complexity region	1058	1082	N/A	INTRINSIC
low complexity region	1187	1200	N/A	INTRINSIC
low complexity region	1204	1227	N/A	INTRINSIC
low complexity region	1268	1289	N/A	INTRINSIC
low complexity region	1294	1306	N/A	INTRINSIC
coiled coil region	1374	1406	N/A	INTRINSIC
low complexity region	1476	1496	N/A	INTRINSIC
low complexity region	1508	1523	N/A	INTRINSIC
low complexity region	1526	1547	N/A	INTRINSIC
coiled coil region	1598	1625	N/A	INTRINSIC
low complexity region	1770	1781	N/A	INTRINSIC
low complexity region	1874	1885	N/A	INTRINSIC
low complexity region	1913	1922	N/A	INTRINSIC
low complexity region	1969	1979	N/A	INTRINSIC
low complexity region	2035	2045	N/A	INTRINSIC
low complexity region	2057	2071	N/A	INTRINSIC
low complexity region	2162	2179	N/A	INTRINSIC
low complexity region	2191	2209	N/A	INTRINSIC
low complexity region	2224	2236	N/A	INTRINSIC
low complexity region	2250	2263	N/A	INTRINSIC
low complexity region	2294	2305	N/A	INTRINSIC
low complexity region	2391	2409	N/A	INTRINSIC
low complexity region	2445	2455	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098334
AA Change: T1129S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000095939
Gene: ENSMUSG00000035569
AA Change: T1129S

Domain	Start	End	E-Value	Type
ANK	167	196	2.58e-3	SMART
ANK	200	229	1.31e-4	SMART
ANK	233	262	5.04e-6	SMART
low complexity region	290	303	N/A	INTRINSIC
low complexity region	345	356	N/A	INTRINSIC
low complexity region	408	419	N/A	INTRINSIC
low complexity region	449	466	N/A	INTRINSIC
low complexity region	478	500	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	575	588	N/A	INTRINSIC
low complexity region	628	648	N/A	INTRINSIC
coiled coil region	765	805	N/A	INTRINSIC
low complexity region	846	856	N/A	INTRINSIC
low complexity region	944	963	N/A	INTRINSIC
low complexity region	1019	1034	N/A	INTRINSIC
low complexity region	1037	1061	N/A	INTRINSIC
low complexity region	1166	1179	N/A	INTRINSIC
low complexity region	1183	1206	N/A	INTRINSIC
low complexity region	1247	1268	N/A	INTRINSIC
low complexity region	1273	1285	N/A	INTRINSIC
coiled coil region	1353	1385	N/A	INTRINSIC
low complexity region	1455	1475	N/A	INTRINSIC
low complexity region	1487	1502	N/A	INTRINSIC
low complexity region	1505	1526	N/A	INTRINSIC
coiled coil region	1577	1604	N/A	INTRINSIC
low complexity region	1749	1760	N/A	INTRINSIC
low complexity region	1853	1864	N/A	INTRINSIC
low complexity region	1892	1901	N/A	INTRINSIC
low complexity region	1948	1958	N/A	INTRINSIC
low complexity region	2014	2024	N/A	INTRINSIC
low complexity region	2036	2050	N/A	INTRINSIC
low complexity region	2141	2158	N/A	INTRINSIC
low complexity region	2170	2188	N/A	INTRINSIC
low complexity region	2203	2215	N/A	INTRINSIC
low complexity region	2229	2242	N/A	INTRINSIC
low complexity region	2273	2284	N/A	INTRINSIC
low complexity region	2370	2388	N/A	INTRINSIC
low complexity region	2424	2434	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172906

Predicted Effect

probably benign
Transcript: ENSMUST00000212050

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes an ankryin repeat domain-containing protein. The encoded protein inhibits ligand-dependent activation of transcription. Mutations in this gene have been associated with KBG syndrome, which is characterized by macrodontia, distinctive craniofacial features, short stature, skeletal anomalies, global developmental delay, seizures and intellectual disability. Alternatively spliced transcript variants have been described. Related pseudogenes exist on chromosomes 2 and X. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele die by E9.5, are small and fail to turn. Mice heterozygous for a spontaneous allele exhibit craniofacial abnormalities, decreased weight, osteoporosis and osteopenia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	G	T	16: 89,063,730	S72Y	unknown	Het
6430531B16Rik	T	C	7: 139,976,618	N152S	probably benign	Het
Abca8b	T	A	11: 109,935,717	K1568N	probably benign	Het
Adcy6	T	A	15: 98,596,067	Y865F	probably benign	Het
Adgrf3	A	T	5: 30,197,206	V608D	probably benign	Het
Agbl1	G	T	7: 76,766,369	A965S	unknown	Het
Agbl3	C	T	6: 34,832,508	P690L	probably benign	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Amt	A	C	9: 108,297,231	H65P	probably damaging	Het
Arhgap15	A	C	2: 44,142,268	H288P	probably benign	Het
Arhgap39	A	T	15: 76,737,417	M328K	probably benign	Het
Arhgef12	T	C	9: 42,992,536	K743R	probably damaging	Het
Atg2a	T	G	19: 6,251,263	V789G	probably damaging	Het
Ccdc54	T	C	16: 50,590,481	T141A	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdh5	T	C	8: 104,129,401		probably null	Het
Cdkl3	T	C	11: 52,027,182	V404A	not run	Het
Chrm2	A	T	6: 36,523,249	I14F	probably benign	Het
Cnbp	T	C	6: 87,845,276	K89E	possibly damaging	Het
Cntn6	T	A	6: 104,650,483	D92E	probably benign	Het
Col15a1	T	C	4: 47,245,591	F114S	possibly damaging	Het
Csrnp1	A	G	9: 119,972,403	F530S	probably benign	Het
Dcun1d3	C	T	7: 119,857,668	V274M	probably damaging	Het
Dph2	T	A	4: 117,890,281	H302L	possibly damaging	Het
Fam162a	A	T	16: 36,046,400	Y118*	probably null	Het
Fam186a	A	G	15: 99,939,844	Y2840H	unknown	Het
Fto	A	G	8: 91,666,322	K466E	probably benign	Het
Gal	T	A	19: 3,413,309	Y41F	probably damaging	Het
Gigyf2	A	T	1: 87,419,138	L620F	unknown	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Glud1	A	T	14: 34,311,157	E87V	probably benign	Het
Gm21190	T	G	5: 15,527,925	E94A	possibly damaging	Het
Gm5592	T	C	7: 41,288,710	V472A	probably benign	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gpn2	A	G	4: 133,591,376	E304G	probably benign	Het
Gsdmc2	T	C	15: 63,825,054	T423A	probably damaging	Het
Gucy2e	G	A	11: 69,226,229	Q789*	probably null	Het
Gxylt2	T	A	6: 100,783,143	V213E	probably damaging	Het
Ighv1-75	G	A	12: 115,834,111	L64F	possibly damaging	Het
Il17re	T	C	6: 113,458,982	C30R	probably benign	Het
Il7	G	T	3: 7,604,082	D31E	probably benign	Het
Ints4	T	C	7: 97,529,253	Y687H	possibly damaging	Het
Kdelr1	T	G	7: 45,882,977	V202G	probably benign	Het
Khnyn	C	A	14: 55,887,139	Y283*	probably null	Het
Klf11	T	C	12: 24,653,671	V52A	probably damaging	Het
Klhl7	A	G	5: 24,141,286	N310S	probably benign	Het
Krt27	A	T	11: 99,349,486	L202Q	possibly damaging	Het
Lce1d	A	G	3: 92,686,047	C20R	unknown	Het
Lim2	A	T	7: 43,433,630	I80F	possibly damaging	Het
Lrrk2	T	A	15: 91,700,358	F326Y	possibly damaging	Het
Lyst	A	T	13: 13,730,476	Y3246F	possibly damaging	Het
Mafb	T	A	2: 160,366,435	H81L	possibly damaging	Het
Mfsd5	G	A	15: 102,280,877	R228H	probably benign	Het
Mmp1b	A	T	9: 7,386,675	F150I	possibly damaging	Het
Mthfd1	T	A	12: 76,270,435	L20Q	probably damaging	Het
Mxra8	A	G	4: 155,842,963	T402A	probably benign	Het
Ndc80	A	T	17: 71,508,663	L376M	probably damaging	Het
Nsd1	A	T	13: 55,277,639	R1536S	probably damaging	Het
Nup210l	C	A	3: 90,211,993	H1874Q	probably benign	Het
Nyap1	T	C	5: 137,732,974	H776R	probably benign	Het
Patj	C	A	4: 98,688,179	H1773Q	probably damaging	Het
Pax8	T	A	2: 24,436,511	T280S	probably benign	Het
Pcdhb19	A	G	18: 37,498,981	T610A	probably damaging	Het
Pde2a	A	G	7: 101,511,581	D919G	possibly damaging	Het
Pdk2	T	A	11: 95,028,965	Y240F	probably damaging	Het
Peg3	A	T	7: 6,709,610	I871N	probably damaging	Het
Pex1	A	T	5: 3,596,244		probably benign	Het
Pgm2l1	C	T	7: 100,250,328	R50W	probably damaging	Het
Phkg1	T	A	5: 129,865,923	K262N	probably damaging	Het
Pik3r4	A	G	9: 105,644,511	E92G	probably damaging	Het
Prmt6	A	T	3: 110,250,385	V196E	possibly damaging	Het
Ptprn2	T	G	12: 116,722,119	M66R	probably benign	Het
Rai14	C	T	15: 10,593,103	G152R	probably damaging	Het
Recql5	A	T	11: 115,923,276	S348T	probably damaging	Het
Rfk	T	G	19: 17,398,682		probably null	Het
Selenbp1	A	T	3: 94,944,102	M389L	probably benign	Het
Sipa1l2	G	A	8: 125,492,290	R103C	probably benign	Het
Slc10a6	T	A	5: 103,629,190	S15C	probably damaging	Het
Slc12a2	G	T	18: 57,932,524	V944L	probably benign	Het
Slc16a11	T	A	11: 70,215,317	L127Q	possibly damaging	Het
St6gal1	A	G	16: 23,356,228	Y272C	probably damaging	Het
Stab2	C	A	10: 86,981,135	V133F	probably benign	Het
Stradb	G	A	1: 58,992,726	V266I	probably damaging	Het
Tmem150b	A	G	7: 4,720,759	W140R	probably benign	Het
Tnnt3	A	T	7: 142,512,096	K157*	probably null	Het
Trove2	T	C	1: 143,770,873	T45A	probably damaging	Het
Ttn	T	G	2: 76,723,769	K30863N	probably damaging	Het
Vldlr	G	A	19: 27,243,136	R592H	probably benign	Het
Vmn1r12	A	T	6: 57,158,898		probably benign	Het
Vmn2r63	A	C	7: 42,925,269	S519R	probably damaging	Het
Zbtb22	G	C	17: 33,918,497	E539Q	probably damaging	Het
Zbtb44	G	A	9: 31,054,079	A262T	probably benign	Het
Zfp280d	A	T	9: 72,324,072	N455I	probably damaging	Het
Zfp287	T	C	11: 62,725,263	N201D	probably damaging	Het
Zfp988	T	C	4: 147,332,294	L395P	probably damaging	Het

Other mutations in Ankrd11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ankrd11	APN	8	122908728	missense	possibly damaging	0.59
IGL00971:Ankrd11	APN	8	122895353	missense	probably damaging	1.00
IGL01017:Ankrd11	APN	8	122894728	missense	probably damaging	1.00
IGL01137:Ankrd11	APN	8	122884336	missense	probably damaging	0.99
IGL01659:Ankrd11	APN	8	122895371	missense	probably damaging	1.00
IGL01920:Ankrd11	APN	8	122915897	splice site	probably benign
IGL01964:Ankrd11	APN	8	122889736	missense	probably damaging	0.97
IGL02131:Ankrd11	APN	8	122894410	missense	probably damaging	1.00
IGL02226:Ankrd11	APN	8	122892245	missense	probably damaging	1.00
IGL02549:Ankrd11	APN	8	122891293	missense	probably damaging	1.00
IGL02642:Ankrd11	APN	8	122890651	missense	probably damaging	1.00
IGL02643:Ankrd11	APN	8	122892322	missense	probably damaging	0.98
IGL02861:Ankrd11	APN	8	122895827	missense	probably damaging	0.99
IGL03086:Ankrd11	APN	8	122894510	missense	probably damaging	1.00
IGL03336:Ankrd11	APN	8	122891843	missense	probably benign	0.00
anchors	UTSW	8	122895770	missense	probably damaging	0.99
away	UTSW	8	122891953	missense	probably damaging	1.00
bluebell	UTSW	8	122891785	missense	probably damaging	0.97
Navy	UTSW	8	122908734	nonsense	probably null
BB001:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
BB011:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0051:Ankrd11	UTSW	8	122889742	missense	probably damaging	1.00
R0110:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0281:Ankrd11	UTSW	8	122895568	missense	probably benign	0.01
R0450:Ankrd11	UTSW	8	122892175	missense	possibly damaging	0.95
R0481:Ankrd11	UTSW	8	122900036	missense	probably damaging	1.00
R0542:Ankrd11	UTSW	8	122895770	missense	probably damaging	0.99
R0606:Ankrd11	UTSW	8	122892832	missense	probably benign	0.04
R0702:Ankrd11	UTSW	8	122889766	missense	probably damaging	1.00
R0730:Ankrd11	UTSW	8	122891953	missense	probably damaging	1.00
R0737:Ankrd11	UTSW	8	122895836	missense	probably damaging	0.99
R1401:Ankrd11	UTSW	8	122893050	missense	probably benign	0.23
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1464:Ankrd11	UTSW	8	122892724	missense	probably damaging	1.00
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1470:Ankrd11	UTSW	8	122899724	missense	probably damaging	0.98
R1641:Ankrd11	UTSW	8	122891746	missense	probably benign	0.03
R1950:Ankrd11	UTSW	8	122889869	missense	probably damaging	1.00
R2004:Ankrd11	UTSW	8	122902422	critical splice donor site	probably null
R2401:Ankrd11	UTSW	8	122908734	nonsense	probably null
R2425:Ankrd11	UTSW	8	122893163	missense	possibly damaging	0.86
R2830:Ankrd11	UTSW	8	122892196	missense	probably damaging	1.00
R2910:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R2911:Ankrd11	UTSW	8	122908798	missense	probably damaging	1.00
R3736:Ankrd11	UTSW	8	122891785	missense	probably damaging	0.97
R3738:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3739:Ankrd11	UTSW	8	122896715	unclassified	probably benign
R3813:Ankrd11	UTSW	8	122891378	missense	probably benign
R4012:Ankrd11	UTSW	8	122892417	missense	probably damaging	0.98
R4183:Ankrd11	UTSW	8	122899676	missense	possibly damaging	0.88
R4213:Ankrd11	UTSW	8	122891026	missense	probably benign	0.00
R4469:Ankrd11	UTSW	8	122896587	missense	probably damaging	1.00
R4482:Ankrd11	UTSW	8	122893489	missense	probably damaging	1.00
R4935:Ankrd11	UTSW	8	122900183	missense	probably benign	0.02
R4940:Ankrd11	UTSW	8	122889821	missense	probably damaging	1.00
R5145:Ankrd11	UTSW	8	122891204	utr 3 prime	probably benign
R5154:Ankrd11	UTSW	8	122893139	missense	probably damaging	1.00
R5230:Ankrd11	UTSW	8	122890477	missense	probably benign	0.11
R5283:Ankrd11	UTSW	8	122884182	missense	probably damaging	1.00
R5377:Ankrd11	UTSW	8	122893714	splice site	probably null
R5513:Ankrd11	UTSW	8	122892520	missense	probably benign	0.38
R5518:Ankrd11	UTSW	8	122890994	missense	possibly damaging	0.93
R5549:Ankrd11	UTSW	8	122890378	missense	probably benign	0.02
R5579:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R5595:Ankrd11	UTSW	8	122894304	nonsense	probably null
R5650:Ankrd11	UTSW	8	122887397	missense	probably damaging	0.99
R5717:Ankrd11	UTSW	8	122892638	missense	possibly damaging	0.92
R5753:Ankrd11	UTSW	8	122895304	missense	possibly damaging	0.90
R5782:Ankrd11	UTSW	8	122900017	missense	probably damaging	1.00
R5812:Ankrd11	UTSW	8	122893805	splice site	probably null
R5823:Ankrd11	UTSW	8	122895790	missense	probably benign	0.12
R5900:Ankrd11	UTSW	8	122891066	missense	probably benign	0.00
R5975:Ankrd11	UTSW	8	122889749	missense	possibly damaging	0.93
R5979:Ankrd11	UTSW	8	122892400	missense	probably damaging	1.00
R6000:Ankrd11	UTSW	8	122891195	missense	possibly damaging	0.73
R6145:Ankrd11	UTSW	8	122892661	missense	probably damaging	1.00
R6252:Ankrd11	UTSW	8	122893822	missense	possibly damaging	0.87
R6302:Ankrd11	UTSW	8	122889989	missense	probably benign
R6457:Ankrd11	UTSW	8	122908764	missense	probably damaging	1.00
R6513:Ankrd11	UTSW	8	122890180	missense	probably benign	0.02
R6582:Ankrd11	UTSW	8	122891629	missense	probably benign	0.00
R6738:Ankrd11	UTSW	8	122891921	missense	probably damaging	0.99
R6865:Ankrd11	UTSW	8	122894944	missense	probably benign	0.41
R6913:Ankrd11	UTSW	8	122894911	missense	probably benign	0.01
R7101:Ankrd11	UTSW	8	122895455	missense	probably benign	0.35
R7116:Ankrd11	UTSW	8	122896130	missense	probably damaging	1.00
R7477:Ankrd11	UTSW	8	122894385	missense	possibly damaging	0.91
R7534:Ankrd11	UTSW	8	122894410	missense	probably damaging	1.00
R7555:Ankrd11	UTSW	8	122887406	missense	probably damaging	0.99
R7627:Ankrd11	UTSW	8	122890951	missense	possibly damaging	0.63
R7721:Ankrd11	UTSW	8	122894759	missense	probably damaging	1.00
R7731:Ankrd11	UTSW	8	122895433	missense	probably benign	0.12
R7792:Ankrd11	UTSW	8	122884231	missense	probably damaging	0.97
R7924:Ankrd11	UTSW	8	122895902	missense	possibly damaging	0.95
R7939:Ankrd11	UTSW	8	122891073	missense	probably damaging	1.00
R8022:Ankrd11	UTSW	8	122887593	missense	probably damaging	1.00
R8222:Ankrd11	UTSW	8	122895608	missense	probably damaging	0.98
R8362:Ankrd11	UTSW	8	122892058	missense	probably damaging	0.96
R8430:Ankrd11	UTSW	8	122893366	missense	probably benign	0.01
R8511:Ankrd11	UTSW	8	122899729	missense
R8726:Ankrd11	UTSW	8	122894026	missense	possibly damaging	0.90
RF019:Ankrd11	UTSW	8	122896634	missense	probably damaging	1.00
Z1176:Ankrd11	UTSW	8	122895803	missense	possibly damaging	0.68
Z1177:Ankrd11	UTSW	8	122900142	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTTCTGGGGCAGAGTCAGC -3'
(R):5'- GCATCCTTTGACCAACTGAGAG -3'

Sequencing Primer
(F):5'- GAGGCTCGCTCTTTCCTG -3'
(R):5'- CATCCTTTGACCAACTGAGAGAGAAG -3'

Posted On

2019-11-12