Incidental Mutation 'R7658:Zfp280d'
ID591367
Institutional Source Beutler Lab
Gene Symbol Zfp280d
Ensembl Gene ENSMUSG00000038535
Gene Namezinc finger protein 280D
SynonymsSuhw4
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_146224.4; MGI:2384583

Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R7658 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location72274860-72363777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 72324072 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 455 (N455I)
Ref Sequence ENSEMBL: ENSMUSP00000096175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098576] [ENSMUST00000183410] [ENSMUST00000183801] [ENSMUST00000184036] [ENSMUST00000184053] [ENSMUST00000184399] [ENSMUST00000184517]
Predicted Effect probably damaging
Transcript: ENSMUST00000098576
AA Change: N455I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096175
Gene: ENSMUSG00000038535
AA Change: N455I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 241 6.8e-82 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183410
AA Change: N455I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139250
Gene: ENSMUSG00000038535
AA Change: N455I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 4.1e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000183801
AA Change: N455I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139091
Gene: ENSMUSG00000038535
AA Change: N455I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 1.9e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184036
AA Change: N430I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138857
Gene: ENSMUSG00000038535
AA Change: N430I

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 18 30 N/A INTRINSIC
Pfam:DUF4195 32 217 5.5e-98 PFAM
ZnF_C2H2 227 247 1.24e2 SMART
ZnF_C2H2 308 330 6.92e0 SMART
ZnF_C2H2 345 368 3.99e0 SMART
ZnF_C2H2 375 398 1.08e-1 SMART
ZnF_C2H2 405 428 3.52e-1 SMART
ZnF_C2H2 434 456 2.41e1 SMART
ZnF_C2H2 462 484 3.38e1 SMART
low complexity region 514 536 N/A INTRINSIC
low complexity region 566 586 N/A INTRINSIC
ZnF_C2H2 631 654 1.23e1 SMART
ZnF_C2H2 677 701 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184053
SMART Domains Protein: ENSMUSP00000138848
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 147 1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184399
SMART Domains Protein: ENSMUSP00000138902
Gene: ENSMUSG00000038535

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 103 4.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184517
AA Change: N455I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138970
Gene: ENSMUSG00000038535
AA Change: N455I

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
Pfam:DUF4195 57 242 2.2e-98 PFAM
ZnF_C2H2 252 272 1.24e2 SMART
ZnF_C2H2 333 355 6.92e0 SMART
ZnF_C2H2 370 393 3.99e0 SMART
ZnF_C2H2 400 423 1.08e-1 SMART
ZnF_C2H2 430 453 3.52e-1 SMART
ZnF_C2H2 459 481 2.41e1 SMART
ZnF_C2H2 487 509 3.38e1 SMART
low complexity region 539 561 N/A INTRINSIC
low complexity region 591 611 N/A INTRINSIC
ZnF_C2H2 656 679 1.23e1 SMART
ZnF_C2H2 702 726 1.34e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184786
Predicted Effect probably benign
Transcript: ENSMUST00000185020
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(100) : Targeted(2) Gene trapped(98)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 89,063,730 S72Y unknown Het
6430531B16Rik T C 7: 139,976,618 N152S probably benign Het
Abca8b T A 11: 109,935,717 K1568N probably benign Het
Adcy6 T A 15: 98,596,067 Y865F probably benign Het
Adgrf3 A T 5: 30,197,206 V608D probably benign Het
Agbl1 G T 7: 76,766,369 A965S unknown Het
Agbl3 C T 6: 34,832,508 P690L probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amt A C 9: 108,297,231 H65P probably damaging Het
Ankrd11 T A 8: 122,893,664 T1150S probably benign Het
Arhgap15 A C 2: 44,142,268 H288P probably benign Het
Arhgap39 A T 15: 76,737,417 M328K probably benign Het
Arhgef12 T C 9: 42,992,536 K743R probably damaging Het
Atg2a T G 19: 6,251,263 V789G probably damaging Het
Ccdc54 T C 16: 50,590,481 T141A probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh5 T C 8: 104,129,401 probably null Het
Cdkl3 T C 11: 52,027,182 V404A not run Het
Chrm2 A T 6: 36,523,249 I14F probably benign Het
Cnbp T C 6: 87,845,276 K89E possibly damaging Het
Cntn6 T A 6: 104,650,483 D92E probably benign Het
Col15a1 T C 4: 47,245,591 F114S possibly damaging Het
Csrnp1 A G 9: 119,972,403 F530S probably benign Het
Dcun1d3 C T 7: 119,857,668 V274M probably damaging Het
Dph2 T A 4: 117,890,281 H302L possibly damaging Het
Fam162a A T 16: 36,046,400 Y118* probably null Het
Fam186a A G 15: 99,939,844 Y2840H unknown Het
Fto A G 8: 91,666,322 K466E probably benign Het
Gal T A 19: 3,413,309 Y41F probably damaging Het
Gigyf2 A T 1: 87,419,138 L620F unknown Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Glud1 A T 14: 34,311,157 E87V probably benign Het
Gm21190 T G 5: 15,527,925 E94A possibly damaging Het
Gm5592 T C 7: 41,288,710 V472A probably benign Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gpn2 A G 4: 133,591,376 E304G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Gucy2e G A 11: 69,226,229 Q789* probably null Het
Gxylt2 T A 6: 100,783,143 V213E probably damaging Het
Ighv1-75 G A 12: 115,834,111 L64F possibly damaging Het
Il17re T C 6: 113,458,982 C30R probably benign Het
Il7 G T 3: 7,604,082 D31E probably benign Het
Ints4 T C 7: 97,529,253 Y687H possibly damaging Het
Kdelr1 T G 7: 45,882,977 V202G probably benign Het
Khnyn C A 14: 55,887,139 Y283* probably null Het
Klf11 T C 12: 24,653,671 V52A probably damaging Het
Klhl7 A G 5: 24,141,286 N310S probably benign Het
Krt27 A T 11: 99,349,486 L202Q possibly damaging Het
Lce1d A G 3: 92,686,047 C20R unknown Het
Lim2 A T 7: 43,433,630 I80F possibly damaging Het
Lrrk2 T A 15: 91,700,358 F326Y possibly damaging Het
Lyst A T 13: 13,730,476 Y3246F possibly damaging Het
Mafb T A 2: 160,366,435 H81L possibly damaging Het
Mfsd5 G A 15: 102,280,877 R228H probably benign Het
Mmp1b A T 9: 7,386,675 F150I possibly damaging Het
Mthfd1 T A 12: 76,270,435 L20Q probably damaging Het
Mxra8 A G 4: 155,842,963 T402A probably benign Het
Ndc80 A T 17: 71,508,663 L376M probably damaging Het
Nsd1 A T 13: 55,277,639 R1536S probably damaging Het
Nup210l C A 3: 90,211,993 H1874Q probably benign Het
Nyap1 T C 5: 137,732,974 H776R probably benign Het
Patj C A 4: 98,688,179 H1773Q probably damaging Het
Pax8 T A 2: 24,436,511 T280S probably benign Het
Pcdhb19 A G 18: 37,498,981 T610A probably damaging Het
Pde2a A G 7: 101,511,581 D919G possibly damaging Het
Pdk2 T A 11: 95,028,965 Y240F probably damaging Het
Peg3 A T 7: 6,709,610 I871N probably damaging Het
Pex1 A T 5: 3,596,244 probably benign Het
Pgm2l1 C T 7: 100,250,328 R50W probably damaging Het
Phkg1 T A 5: 129,865,923 K262N probably damaging Het
Pik3r4 A G 9: 105,644,511 E92G probably damaging Het
Prmt6 A T 3: 110,250,385 V196E possibly damaging Het
Ptprn2 T G 12: 116,722,119 M66R probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Recql5 A T 11: 115,923,276 S348T probably damaging Het
Rfk T G 19: 17,398,682 probably null Het
Selenbp1 A T 3: 94,944,102 M389L probably benign Het
Sipa1l2 G A 8: 125,492,290 R103C probably benign Het
Slc10a6 T A 5: 103,629,190 S15C probably damaging Het
Slc12a2 G T 18: 57,932,524 V944L probably benign Het
Slc16a11 T A 11: 70,215,317 L127Q possibly damaging Het
St6gal1 A G 16: 23,356,228 Y272C probably damaging Het
Stab2 C A 10: 86,981,135 V133F probably benign Het
Stradb G A 1: 58,992,726 V266I probably damaging Het
Tmem150b A G 7: 4,720,759 W140R probably benign Het
Tnnt3 A T 7: 142,512,096 K157* probably null Het
Trove2 T C 1: 143,770,873 T45A probably damaging Het
Ttn T G 2: 76,723,769 K30863N probably damaging Het
Vldlr G A 19: 27,243,136 R592H probably benign Het
Vmn1r12 A T 6: 57,158,898 probably benign Het
Vmn2r63 A C 7: 42,925,269 S519R probably damaging Het
Zbtb22 G C 17: 33,918,497 E539Q probably damaging Het
Zbtb44 G A 9: 31,054,079 A262T probably benign Het
Zfp287 T C 11: 62,725,263 N201D probably damaging Het
Zfp988 T C 4: 147,332,294 L395P probably damaging Het
Other mutations in Zfp280d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Zfp280d APN 9 72322571 missense probably damaging 1.00
IGL00708:Zfp280d APN 9 72312135 missense probably benign 0.19
IGL01333:Zfp280d APN 9 72335114 splice site probably benign
IGL01453:Zfp280d APN 9 72322586 missense possibly damaging 0.90
IGL02472:Zfp280d APN 9 72301711 missense probably damaging 1.00
IGL02583:Zfp280d APN 9 72322445 splice site probably benign
IGL02608:Zfp280d APN 9 72307979 missense probably damaging 0.98
IGL02675:Zfp280d APN 9 72312222 missense probably benign 0.33
IGL02676:Zfp280d APN 9 72335074 missense probably damaging 1.00
IGL02931:Zfp280d APN 9 72296025 missense probably benign 0.02
IGL03076:Zfp280d APN 9 72312662 missense probably damaging 0.99
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0017:Zfp280d UTSW 9 72339010 critical splice acceptor site probably null
R0288:Zfp280d UTSW 9 72331339 nonsense probably null
R0419:Zfp280d UTSW 9 72312237 missense probably benign 0.02
R0540:Zfp280d UTSW 9 72307965 missense probably damaging 0.97
R0628:Zfp280d UTSW 9 72361948 missense probably benign
R0722:Zfp280d UTSW 9 72312101 missense possibly damaging 0.63
R1055:Zfp280d UTSW 9 72329167 splice site probably null
R1786:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R1826:Zfp280d UTSW 9 72298780 missense probably damaging 1.00
R1962:Zfp280d UTSW 9 72335080 nonsense probably null
R2130:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2132:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2133:Zfp280d UTSW 9 72308005 missense probably damaging 1.00
R2143:Zfp280d UTSW 9 72312729 missense probably damaging 1.00
R2162:Zfp280d UTSW 9 72298822 missense probably damaging 1.00
R2266:Zfp280d UTSW 9 72301770 splice site probably benign
R2269:Zfp280d UTSW 9 72301770 splice site probably benign
R2278:Zfp280d UTSW 9 72338773 nonsense probably null
R2850:Zfp280d UTSW 9 72312089 missense probably benign 0.06
R3780:Zfp280d UTSW 9 72322524 missense probably damaging 1.00
R3950:Zfp280d UTSW 9 72296019 missense possibly damaging 0.49
R4330:Zfp280d UTSW 9 72295979 missense possibly damaging 0.86
R4716:Zfp280d UTSW 9 72312665 missense possibly damaging 0.94
R4876:Zfp280d UTSW 9 72298858 splice site probably benign
R4909:Zfp280d UTSW 9 72331432 missense probably damaging 1.00
R5214:Zfp280d UTSW 9 72308113 unclassified probably benign
R5518:Zfp280d UTSW 9 72324135 missense probably damaging 0.99
R5853:Zfp280d UTSW 9 72330942 missense probably benign 0.20
R5945:Zfp280d UTSW 9 72362332 nonsense probably null
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R6033:Zfp280d UTSW 9 72329137 missense probably damaging 1.00
R7043:Zfp280d UTSW 9 72319257 missense probably damaging 1.00
R7501:Zfp280d UTSW 9 72361942 missense possibly damaging 0.65
R7667:Zfp280d UTSW 9 72301965 missense probably damaging 1.00
R7792:Zfp280d UTSW 9 72331319 missense probably damaging 1.00
R7826:Zfp280d UTSW 9 72312671 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TCTTCAGCTTTGAAGGATCACC -3'
(R):5'- GTCAACTGTTTAGAGACCAAGTATCAC -3'

Sequencing Primer
(F):5'- GAGCTGGGTTGACAGTATAT -3'
(R):5'- GTGGAAGTTTCACAAATGATTCAG -3'
Posted On2019-11-12