Mutagenetix > Incidental Mutations

Incidental Mutation 'R7658:Abca8b'

591378

Institutional Source

Beutler Lab

Gene Symbol

Abca8b

Ensembl Gene

ENSMUSG00000020620

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 8b

Synonyms

Abca8

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

109932190-109995845 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 109935717 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 1568 (K1568N)

Ref Sequence

ENSEMBL: ENSMUSP00000020948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]

Predicted Effect

probably benign
Transcript: ENSMUST00000020948
AA Change: K1568N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: K1568N

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	417	3.9e-28	PFAM
AAA	507	691	6.36e-10	SMART
Pfam:ABC2_membrane_3	859	1215	1e-10	PFAM
low complexity region	1246	1255	N/A	INTRINSIC
AAA	1313	1492	6.17e-8	SMART
low complexity region	1597	1607	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106669
AA Change: K1506N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: K1506N

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	344	2.6e-16	PFAM
AAA	445	629	6.36e-10	SMART
transmembrane domain	798	815	N/A	INTRINSIC
transmembrane domain	1001	1023	N/A	INTRINSIC
transmembrane domain	1038	1060	N/A	INTRINSIC
transmembrane domain	1072	1091	N/A	INTRINSIC
transmembrane domain	1101	1123	N/A	INTRINSIC
transmembrane domain	1136	1158	N/A	INTRINSIC
low complexity region	1184	1193	N/A	INTRINSIC
AAA	1251	1430	6.17e-8	SMART
low complexity region	1535	1545	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	G	T	16: 89,063,730	S72Y	unknown	Het
6430531B16Rik	T	C	7: 139,976,618	N152S	probably benign	Het
Adcy6	T	A	15: 98,596,067	Y865F	probably benign	Het
Adgrf3	A	T	5: 30,197,206	V608D	probably benign	Het
Agbl1	G	T	7: 76,766,369	A965S	unknown	Het
Agbl3	C	T	6: 34,832,508	P690L	probably benign	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Amt	A	C	9: 108,297,231	H65P	probably damaging	Het
Ankrd11	T	A	8: 122,893,664	T1150S	probably benign	Het
Arhgap15	A	C	2: 44,142,268	H288P	probably benign	Het
Arhgap39	A	T	15: 76,737,417	M328K	probably benign	Het
Arhgef12	T	C	9: 42,992,536	K743R	probably damaging	Het
Atg2a	T	G	19: 6,251,263	V789G	probably damaging	Het
Ccdc54	T	C	16: 50,590,481	T141A	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdh5	T	C	8: 104,129,401		probably null	Het
Cdkl3	T	C	11: 52,027,182	V404A	not run	Het
Chrm2	A	T	6: 36,523,249	I14F	probably benign	Het
Cnbp	T	C	6: 87,845,276	K89E	possibly damaging	Het
Cntn6	T	A	6: 104,650,483	D92E	probably benign	Het
Col15a1	T	C	4: 47,245,591	F114S	possibly damaging	Het
Csrnp1	A	G	9: 119,972,403	F530S	probably benign	Het
Dcun1d3	C	T	7: 119,857,668	V274M	probably damaging	Het
Dph2	T	A	4: 117,890,281	H302L	possibly damaging	Het
Fam162a	A	T	16: 36,046,400	Y118*	probably null	Het
Fam186a	A	G	15: 99,939,844	Y2840H	unknown	Het
Fto	A	G	8: 91,666,322	K466E	probably benign	Het
Gal	T	A	19: 3,413,309	Y41F	probably damaging	Het
Gigyf2	A	T	1: 87,419,138	L620F	unknown	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Glud1	A	T	14: 34,311,157	E87V	probably benign	Het
Gm21190	T	G	5: 15,527,925	E94A	possibly damaging	Het
Gm5592	T	C	7: 41,288,710	V472A	probably benign	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gpn2	A	G	4: 133,591,376	E304G	probably benign	Het
Gsdmc2	T	C	15: 63,825,054	T423A	probably damaging	Het
Gucy2e	G	A	11: 69,226,229	Q789*	probably null	Het
Gxylt2	T	A	6: 100,783,143	V213E	probably damaging	Het
Ighv1-75	G	A	12: 115,834,111	L64F	possibly damaging	Het
Il17re	T	C	6: 113,458,982	C30R	probably benign	Het
Il7	G	T	3: 7,604,082	D31E	probably benign	Het
Ints4	T	C	7: 97,529,253	Y687H	possibly damaging	Het
Kdelr1	T	G	7: 45,882,977	V202G	probably benign	Het
Khnyn	C	A	14: 55,887,139	Y283*	probably null	Het
Klf11	T	C	12: 24,653,671	V52A	probably damaging	Het
Klhl7	A	G	5: 24,141,286	N310S	probably benign	Het
Krt27	A	T	11: 99,349,486	L202Q	possibly damaging	Het
Lce1d	A	G	3: 92,686,047	C20R	unknown	Het
Lim2	A	T	7: 43,433,630	I80F	possibly damaging	Het
Lrrk2	T	A	15: 91,700,358	F326Y	possibly damaging	Het
Lyst	A	T	13: 13,730,476	Y3246F	possibly damaging	Het
Mafb	T	A	2: 160,366,435	H81L	possibly damaging	Het
Mfsd5	G	A	15: 102,280,877	R228H	probably benign	Het
Mmp1b	A	T	9: 7,386,675	F150I	possibly damaging	Het
Mthfd1	T	A	12: 76,270,435	L20Q	probably damaging	Het
Mxra8	A	G	4: 155,842,963	T402A	probably benign	Het
Ndc80	A	T	17: 71,508,663	L376M	probably damaging	Het
Nsd1	A	T	13: 55,277,639	R1536S	probably damaging	Het
Nup210l	C	A	3: 90,211,993	H1874Q	probably benign	Het
Nyap1	T	C	5: 137,732,974	H776R	probably benign	Het
Patj	C	A	4: 98,688,179	H1773Q	probably damaging	Het
Pax8	T	A	2: 24,436,511	T280S	probably benign	Het
Pcdhb19	A	G	18: 37,498,981	T610A	probably damaging	Het
Pde2a	A	G	7: 101,511,581	D919G	possibly damaging	Het
Pdk2	T	A	11: 95,028,965	Y240F	probably damaging	Het
Peg3	A	T	7: 6,709,610	I871N	probably damaging	Het
Pex1	A	T	5: 3,596,244		probably benign	Het
Pgm2l1	C	T	7: 100,250,328	R50W	probably damaging	Het
Phkg1	T	A	5: 129,865,923	K262N	probably damaging	Het
Pik3r4	A	G	9: 105,644,511	E92G	probably damaging	Het
Prmt6	A	T	3: 110,250,385	V196E	possibly damaging	Het
Ptprn2	T	G	12: 116,722,119	M66R	probably benign	Het
Rai14	C	T	15: 10,593,103	G152R	probably damaging	Het
Recql5	A	T	11: 115,923,276	S348T	probably damaging	Het
Rfk	T	G	19: 17,398,682		probably null	Het
Selenbp1	A	T	3: 94,944,102	M389L	probably benign	Het
Sipa1l2	G	A	8: 125,492,290	R103C	probably benign	Het
Slc10a6	T	A	5: 103,629,190	S15C	probably damaging	Het
Slc12a2	G	T	18: 57,932,524	V944L	probably benign	Het
Slc16a11	T	A	11: 70,215,317	L127Q	possibly damaging	Het
St6gal1	A	G	16: 23,356,228	Y272C	probably damaging	Het
Stab2	C	A	10: 86,981,135	V133F	probably benign	Het
Stradb	G	A	1: 58,992,726	V266I	probably damaging	Het
Tmem150b	A	G	7: 4,720,759	W140R	probably benign	Het
Tnnt3	A	T	7: 142,512,096	K157*	probably null	Het
Trove2	T	C	1: 143,770,873	T45A	probably damaging	Het
Ttn	T	G	2: 76,723,769	K30863N	probably damaging	Het
Vldlr	G	A	19: 27,243,136	R592H	probably benign	Het
Vmn1r12	A	T	6: 57,158,898		probably benign	Het
Vmn2r63	A	C	7: 42,925,269	S519R	probably damaging	Het
Zbtb22	G	C	17: 33,918,497	E539Q	probably damaging	Het
Zbtb44	G	A	9: 31,054,079	A262T	probably benign	Het
Zfp280d	A	T	9: 72,324,072	N455I	probably damaging	Het
Zfp287	T	C	11: 62,725,263	N201D	probably damaging	Het
Zfp988	T	C	4: 147,332,294	L395P	probably damaging	Het

Other mutations in Abca8b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00862:Abca8b	APN	11	109953548	missense	possibly damaging	0.66
IGL00952:Abca8b	APN	11	109969060	critical splice donor site	probably null
IGL01141:Abca8b	APN	11	109937730	missense	probably damaging	1.00
IGL01523:Abca8b	APN	11	109976494	missense	probably damaging	1.00
IGL01633:Abca8b	APN	11	109936754	missense	probably damaging	0.99
IGL01862:Abca8b	APN	11	109947171	nonsense	probably null
IGL01963:Abca8b	APN	11	109971763	missense	probably damaging	0.99
IGL02169:Abca8b	APN	11	109952582	missense	probably damaging	0.98
IGL02536:Abca8b	APN	11	109981748	missense	probably benign	0.02
IGL02658:Abca8b	APN	11	109952560	missense	probably benign
IGL02828:Abca8b	APN	11	109980894	missense	probably damaging	0.99
IGL03118:Abca8b	APN	11	109947181	missense	possibly damaging	0.66
IGL03302:Abca8b	APN	11	109967750	missense	possibly damaging	0.80
IGL03325:Abca8b	APN	11	109953596	missense	possibly damaging	0.94
R0057:Abca8b	UTSW	11	109941559	missense	possibly damaging	0.91
R0131:Abca8b	UTSW	11	109942289	missense	possibly damaging	0.46
R0226:Abca8b	UTSW	11	109957018	splice site	probably null
R0426:Abca8b	UTSW	11	109955027	splice site	probably benign
R0432:Abca8b	UTSW	11	109980015	missense	possibly damaging	0.94
R0512:Abca8b	UTSW	11	109950650	missense	probably benign	0.32
R0589:Abca8b	UTSW	11	109942268	missense	probably damaging	0.96
R0690:Abca8b	UTSW	11	109969808	splice site	probably benign
R1263:Abca8b	UTSW	11	109941607	missense	possibly damaging	0.66
R1371:Abca8b	UTSW	11	109953553	missense	probably damaging	0.99
R1497:Abca8b	UTSW	11	109973821	splice site	probably benign
R1502:Abca8b	UTSW	11	109974645	missense	probably damaging	1.00
R1517:Abca8b	UTSW	11	109971814	missense	possibly damaging	0.66
R1543:Abca8b	UTSW	11	109974674	missense	probably damaging	0.98
R1618:Abca8b	UTSW	11	109949888	splice site	probably benign
R1625:Abca8b	UTSW	11	109967121	missense	probably benign	0.11
R1753:Abca8b	UTSW	11	109973716	missense	probably benign	0.00
R1819:Abca8b	UTSW	11	109981056	critical splice acceptor site	probably null
R1822:Abca8b	UTSW	11	109957075	missense	possibly damaging	0.92
R1829:Abca8b	UTSW	11	109942341	missense	probably damaging	0.97
R1873:Abca8b	UTSW	11	109979955	missense	probably benign	0.01
R1899:Abca8b	UTSW	11	109937918	missense	possibly damaging	0.92
R1908:Abca8b	UTSW	11	109957098	missense	possibly damaging	0.92
R1962:Abca8b	UTSW	11	109979898	missense	probably benign	0.00
R1984:Abca8b	UTSW	11	109977841	missense	probably damaging	1.00
R2035:Abca8b	UTSW	11	109957106	missense	possibly damaging	0.94
R2092:Abca8b	UTSW	11	109966708	missense	possibly damaging	0.63
R2100:Abca8b	UTSW	11	109937782	missense	probably damaging	1.00
R2267:Abca8b	UTSW	11	109955148	missense	probably benign	0.03
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2871:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2872:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R2873:Abca8b	UTSW	11	109955176	missense	possibly damaging	0.83
R3711:Abca8b	UTSW	11	109946255	missense	possibly damaging	0.46
R3937:Abca8b	UTSW	11	109974567	missense	probably benign	0.01
R4052:Abca8b	UTSW	11	109981725	nonsense	probably null
R4060:Abca8b	UTSW	11	109957201	missense	probably benign	0.04
R4207:Abca8b	UTSW	11	109981725	nonsense	probably null
R4208:Abca8b	UTSW	11	109981725	nonsense	probably null
R4354:Abca8b	UTSW	11	109971692	missense	probably benign	0.27
R4399:Abca8b	UTSW	11	109936385	missense	possibly damaging	0.66
R4456:Abca8b	UTSW	11	109942245	missense	probably benign	0.27
R4509:Abca8b	UTSW	11	109966755	missense	probably damaging	1.00
R4672:Abca8b	UTSW	11	109936448	missense	possibly damaging	0.81
R4868:Abca8b	UTSW	11	109974512	missense	probably benign	0.05
R5002:Abca8b	UTSW	11	109961797	missense	probably damaging	0.96
R5007:Abca8b	UTSW	11	109936764	missense	probably damaging	1.00
R5014:Abca8b	UTSW	11	109950131	missense	probably damaging	0.98
R5023:Abca8b	UTSW	11	109974988	critical splice donor site	probably null
R5091:Abca8b	UTSW	11	109936384	missense	possibly damaging	0.92
R5098:Abca8b	UTSW	11	109957118	missense	probably benign	0.05
R5117:Abca8b	UTSW	11	109966803	missense	probably damaging	1.00
R5234:Abca8b	UTSW	11	109976594	missense	possibly damaging	0.90
R5302:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5307:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5487:Abca8b	UTSW	11	109953514	missense	probably damaging	0.99
R5512:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5564:Abca8b	UTSW	11	109934581	missense	probably benign	0.08
R5610:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5677:Abca8b	UTSW	11	109940861	missense	probably damaging	1.00
R5723:Abca8b	UTSW	11	109953619	missense	possibly damaging	0.90
R5827:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5829:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5848:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5849:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5850:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5854:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R5982:Abca8b	UTSW	11	109953597	missense	possibly damaging	0.80
R5994:Abca8b	UTSW	11	109949766	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6035:Abca8b	UTSW	11	109971860	splice site	probably null
R6050:Abca8b	UTSW	11	109977813	missense	probably damaging	1.00
R6145:Abca8b	UTSW	11	109973808	missense	probably benign	0.03
R6223:Abca8b	UTSW	11	109977846	missense	probably benign	0.00
R6349:Abca8b	UTSW	11	109934718	splice site	probably null
R7002:Abca8b	UTSW	11	109941564	missense	probably damaging	1.00
R7050:Abca8b	UTSW	11	109973718	missense	possibly damaging	0.90
R7107:Abca8b	UTSW	11	109976473	missense	probably damaging	0.98
R7158:Abca8b	UTSW	11	109934589	missense	probably damaging	1.00
R7170:Abca8b	UTSW	11	109945828	missense	probably benign	0.09
R7197:Abca8b	UTSW	11	109945822	nonsense	probably null
R7220:Abca8b	UTSW	11	109981717	missense	probably damaging	1.00
R7512:Abca8b	UTSW	11	109938449	missense	probably benign	0.01
R7590:Abca8b	UTSW	11	109938515	missense	probably damaging	0.97
R7739:Abca8b	UTSW	11	109974591	missense	probably benign	0.05
R7797:Abca8b	UTSW	11	109971683	critical splice donor site	probably null
R7934:Abca8b	UTSW	11	109975039	missense	possibly damaging	0.75
R8074:Abca8b	UTSW	11	109938494	missense	probably benign
R8302:Abca8b	UTSW	11	109962580	critical splice donor site	probably null
R8341:Abca8b	UTSW	11	109955050	missense	probably damaging	1.00
R8486:Abca8b	UTSW	11	109967111	missense	possibly damaging	0.83
R8748:Abca8b	UTSW	11	109945771	missense	probably damaging	1.00
Z1088:Abca8b	UTSW	11	109976482	missense	probably benign	0.09
Z1176:Abca8b	UTSW	11	109961908	missense	possibly damaging	0.52
Z1176:Abca8b	UTSW	11	109974644	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- TTGGAGCCACACCACCACTA -3'
(R):5'- TTCGGGATCAAGATTGTCATTCT -3'

Sequencing Primer
(F):5'- CTCCAATCTCAGGGTTGACAATG -3'
(R):5'- GTGATTGCACAGTCCTGTAATC -3'

Posted On

2019-11-12