Incidental Mutation 'R7658:Abca8b'
ID 591378
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene Name ATP-binding cassette, sub-family A (ABC1), member 8b
Synonyms Abca8
MMRRC Submission 045703-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7658 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 109932190-109995845 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 109935717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 1568 (K1568N)
Ref Sequence ENSEMBL: ENSMUSP00000020948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
AlphaFold Q8K440
Predicted Effect probably benign
Transcript: ENSMUST00000020948
AA Change: K1568N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: K1568N

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106669
AA Change: K1506N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: K1506N

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 89,063,730 S72Y unknown Het
6430531B16Rik T C 7: 139,976,618 N152S probably benign Het
Adcy6 T A 15: 98,596,067 Y865F probably benign Het
Adgrf3 A T 5: 30,197,206 V608D probably benign Het
Agbl1 G T 7: 76,766,369 A965S unknown Het
Agbl3 C T 6: 34,832,508 P690L probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amt A C 9: 108,297,231 H65P probably damaging Het
Ankrd11 T A 8: 122,893,664 T1150S probably benign Het
Arhgap15 A C 2: 44,142,268 H288P probably benign Het
Arhgap39 A T 15: 76,737,417 M328K probably benign Het
Arhgef12 T C 9: 42,992,536 K743R probably damaging Het
Atg2a T G 19: 6,251,263 V789G probably damaging Het
Ccdc54 T C 16: 50,590,481 T141A probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh5 T C 8: 104,129,401 probably null Het
Cdkl3 T C 11: 52,027,182 V404A not run Het
Chrm2 A T 6: 36,523,249 I14F probably benign Het
Cnbp T C 6: 87,845,276 K89E possibly damaging Het
Cntn6 T A 6: 104,650,483 D92E probably benign Het
Col15a1 T C 4: 47,245,591 F114S possibly damaging Het
Csrnp1 A G 9: 119,972,403 F530S probably benign Het
Dcun1d3 C T 7: 119,857,668 V274M probably damaging Het
Dph2 T A 4: 117,890,281 H302L possibly damaging Het
Fam162a A T 16: 36,046,400 Y118* probably null Het
Fam186a A G 15: 99,939,844 Y2840H unknown Het
Fto A G 8: 91,666,322 K466E probably benign Het
Gal T A 19: 3,413,309 Y41F probably damaging Het
Gigyf2 A T 1: 87,419,138 L620F unknown Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Glud1 A T 14: 34,311,157 E87V probably benign Het
Gm21190 T G 5: 15,527,925 E94A possibly damaging Het
Gm5592 T C 7: 41,288,710 V472A probably benign Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gpn2 A G 4: 133,591,376 E304G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Gucy2e G A 11: 69,226,229 Q789* probably null Het
Gxylt2 T A 6: 100,783,143 V213E probably damaging Het
Ighv1-75 G A 12: 115,834,111 L64F possibly damaging Het
Il17re T C 6: 113,458,982 C30R probably benign Het
Il7 G T 3: 7,604,082 D31E probably benign Het
Ints4 T C 7: 97,529,253 Y687H possibly damaging Het
Kdelr1 T G 7: 45,882,977 V202G probably benign Het
Khnyn C A 14: 55,887,139 Y283* probably null Het
Klf11 T C 12: 24,653,671 V52A probably damaging Het
Klhl7 A G 5: 24,141,286 N310S probably benign Het
Krt27 A T 11: 99,349,486 L202Q possibly damaging Het
Lce1d A G 3: 92,686,047 C20R unknown Het
Lim2 A T 7: 43,433,630 I80F possibly damaging Het
Lrrk2 T A 15: 91,700,358 F326Y possibly damaging Het
Lyst A T 13: 13,730,476 Y3246F possibly damaging Het
Mafb T A 2: 160,366,435 H81L possibly damaging Het
Mfsd5 G A 15: 102,280,877 R228H probably benign Het
Mmp1b A T 9: 7,386,675 F150I possibly damaging Het
Mthfd1 T A 12: 76,270,435 L20Q probably damaging Het
Mxra8 A G 4: 155,842,963 T402A probably benign Het
Ndc80 A T 17: 71,508,663 L376M probably damaging Het
Nsd1 A T 13: 55,277,639 R1536S probably damaging Het
Nup210l C A 3: 90,211,993 H1874Q probably benign Het
Nyap1 T C 5: 137,732,974 H776R probably benign Het
Patj C A 4: 98,688,179 H1773Q probably damaging Het
Pax8 T A 2: 24,436,511 T280S probably benign Het
Pcdhb19 A G 18: 37,498,981 T610A probably damaging Het
Pde2a A G 7: 101,511,581 D919G possibly damaging Het
Pdk2 T A 11: 95,028,965 Y240F probably damaging Het
Peg3 A T 7: 6,709,610 I871N probably damaging Het
Pex1 A T 5: 3,596,244 probably benign Het
Pgm2l1 C T 7: 100,250,328 R50W probably damaging Het
Phkg1 T A 5: 129,865,923 K262N probably damaging Het
Pik3r4 A G 9: 105,644,511 E92G probably damaging Het
Prmt6 A T 3: 110,250,385 V196E possibly damaging Het
Ptprn2 T G 12: 116,722,119 M66R probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Recql5 A T 11: 115,923,276 S348T probably damaging Het
Rfk T G 19: 17,398,682 probably null Het
Selenbp1 A T 3: 94,944,102 M389L probably benign Het
Sipa1l2 G A 8: 125,492,290 R103C probably benign Het
Slc10a6 T A 5: 103,629,190 S15C probably damaging Het
Slc12a2 G T 18: 57,932,524 V944L probably benign Het
Slc16a11 T A 11: 70,215,317 L127Q possibly damaging Het
St6gal1 A G 16: 23,356,228 Y272C probably damaging Het
Stab2 C A 10: 86,981,135 V133F probably benign Het
Stradb G A 1: 58,992,726 V266I probably damaging Het
Tmem150b A G 7: 4,720,759 W140R probably benign Het
Tnnt3 A T 7: 142,512,096 K157* probably null Het
Trove2 T C 1: 143,770,873 T45A probably damaging Het
Ttn T G 2: 76,723,769 K30863N probably damaging Het
Vldlr G A 19: 27,243,136 R592H probably benign Het
Vmn1r12 A T 6: 57,158,898 probably benign Het
Vmn2r63 A C 7: 42,925,269 S519R probably damaging Het
Zbtb22 G C 17: 33,918,497 E539Q probably damaging Het
Zbtb44 G A 9: 31,054,079 A262T probably benign Het
Zfp280d A T 9: 72,324,072 N455I probably damaging Het
Zfp287 T C 11: 62,725,263 N201D probably damaging Het
Zfp988 T C 4: 147,332,294 L395P probably damaging Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 splice site probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
R7590:Abca8b UTSW 11 109938515 missense probably damaging 0.97
R7739:Abca8b UTSW 11 109974591 missense probably benign 0.05
R7797:Abca8b UTSW 11 109971683 critical splice donor site probably null
R7934:Abca8b UTSW 11 109975039 missense possibly damaging 0.75
R8074:Abca8b UTSW 11 109938494 missense probably benign
R8302:Abca8b UTSW 11 109962580 critical splice donor site probably null
R8341:Abca8b UTSW 11 109955050 missense probably damaging 1.00
R8486:Abca8b UTSW 11 109967111 missense possibly damaging 0.83
R8748:Abca8b UTSW 11 109945771 missense probably damaging 1.00
R8924:Abca8b UTSW 11 109947177 missense probably benign 0.00
R9002:Abca8b UTSW 11 109952630 missense probably benign 0.02
R9032:Abca8b UTSW 11 109957247 missense probably benign 0.04
R9099:Abca8b UTSW 11 109980882 missense probably damaging 1.00
R9124:Abca8b UTSW 11 109937767 missense probably damaging 0.97
R9178:Abca8b UTSW 11 109950111 missense probably benign 0.00
R9188:Abca8b UTSW 11 109981735 nonsense probably null
R9277:Abca8b UTSW 11 109976521 missense probably damaging 0.99
R9340:Abca8b UTSW 11 109950113 missense probably benign 0.43
R9371:Abca8b UTSW 11 109967672 missense probably damaging 1.00
R9382:Abca8b UTSW 11 109979885 missense probably benign
R9450:Abca8b UTSW 11 109969104 missense probably damaging 0.98
R9462:Abca8b UTSW 11 109953607 missense
R9712:Abca8b UTSW 11 109942337 missense probably benign 0.30
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Z1176:Abca8b UTSW 11 109961908 missense possibly damaging 0.52
Z1176:Abca8b UTSW 11 109974644 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTGGAGCCACACCACCACTA -3'
(R):5'- TTCGGGATCAAGATTGTCATTCT -3'

Sequencing Primer
(F):5'- CTCCAATCTCAGGGTTGACAATG -3'
(R):5'- GTGATTGCACAGTCCTGTAATC -3'
Posted On 2019-11-12