Incidental Mutation 'R7658:Ptprn2'
ID591383
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Nameprotein tyrosine phosphatase, receptor type, N polypeptide 2
Synonymsphogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R7658 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location116485720-117276849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 116722119 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 66 (M66R)
Ref Sequence ENSEMBL: ENSMUSP00000064046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: M66R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: M66R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190247
AA Change: M66R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: M66R

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 89,063,730 S72Y unknown Het
6430531B16Rik T C 7: 139,976,618 N152S probably benign Het
Abca8b T A 11: 109,935,717 K1568N probably benign Het
Adcy6 T A 15: 98,596,067 Y865F probably benign Het
Adgrf3 A T 5: 30,197,206 V608D probably benign Het
Agbl1 G T 7: 76,766,369 A965S unknown Het
Agbl3 C T 6: 34,832,508 P690L probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amt A C 9: 108,297,231 H65P probably damaging Het
Ankrd11 T A 8: 122,893,664 T1150S probably benign Het
Arhgap15 A C 2: 44,142,268 H288P probably benign Het
Arhgap39 A T 15: 76,737,417 M328K probably benign Het
Arhgef12 T C 9: 42,992,536 K743R probably damaging Het
Atg2a T G 19: 6,251,263 V789G probably damaging Het
Ccdc54 T C 16: 50,590,481 T141A probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh5 T C 8: 104,129,401 probably null Het
Cdkl3 T C 11: 52,027,182 V404A not run Het
Chrm2 A T 6: 36,523,249 I14F probably benign Het
Cnbp T C 6: 87,845,276 K89E possibly damaging Het
Cntn6 T A 6: 104,650,483 D92E probably benign Het
Col15a1 T C 4: 47,245,591 F114S possibly damaging Het
Csrnp1 A G 9: 119,972,403 F530S probably benign Het
Dcun1d3 C T 7: 119,857,668 V274M probably damaging Het
Dph2 T A 4: 117,890,281 H302L possibly damaging Het
Fam162a A T 16: 36,046,400 Y118* probably null Het
Fam186a A G 15: 99,939,844 Y2840H unknown Het
Fto A G 8: 91,666,322 K466E probably benign Het
Gal T A 19: 3,413,309 Y41F probably damaging Het
Gigyf2 A T 1: 87,419,138 L620F unknown Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Glud1 A T 14: 34,311,157 E87V probably benign Het
Gm21190 T G 5: 15,527,925 E94A possibly damaging Het
Gm5592 T C 7: 41,288,710 V472A probably benign Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gpn2 A G 4: 133,591,376 E304G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Gucy2e G A 11: 69,226,229 Q789* probably null Het
Gxylt2 T A 6: 100,783,143 V213E probably damaging Het
Ighv1-75 G A 12: 115,834,111 L64F possibly damaging Het
Il17re T C 6: 113,458,982 C30R probably benign Het
Il7 G T 3: 7,604,082 D31E probably benign Het
Ints4 T C 7: 97,529,253 Y687H possibly damaging Het
Kdelr1 T G 7: 45,882,977 V202G probably benign Het
Khnyn C A 14: 55,887,139 Y283* probably null Het
Klf11 T C 12: 24,653,671 V52A probably damaging Het
Klhl7 A G 5: 24,141,286 N310S probably benign Het
Krt27 A T 11: 99,349,486 L202Q possibly damaging Het
Lce1d A G 3: 92,686,047 C20R unknown Het
Lim2 A T 7: 43,433,630 I80F possibly damaging Het
Lrrk2 T A 15: 91,700,358 F326Y possibly damaging Het
Lyst A T 13: 13,730,476 Y3246F possibly damaging Het
Mafb T A 2: 160,366,435 H81L possibly damaging Het
Mfsd5 G A 15: 102,280,877 R228H probably benign Het
Mmp1b A T 9: 7,386,675 F150I possibly damaging Het
Mthfd1 T A 12: 76,270,435 L20Q probably damaging Het
Mxra8 A G 4: 155,842,963 T402A probably benign Het
Ndc80 A T 17: 71,508,663 L376M probably damaging Het
Nsd1 A T 13: 55,277,639 R1536S probably damaging Het
Nup210l C A 3: 90,211,993 H1874Q probably benign Het
Nyap1 T C 5: 137,732,974 H776R probably benign Het
Patj C A 4: 98,688,179 H1773Q probably damaging Het
Pax8 T A 2: 24,436,511 T280S probably benign Het
Pcdhb19 A G 18: 37,498,981 T610A probably damaging Het
Pde2a A G 7: 101,511,581 D919G possibly damaging Het
Pdk2 T A 11: 95,028,965 Y240F probably damaging Het
Peg3 A T 7: 6,709,610 I871N probably damaging Het
Pex1 A T 5: 3,596,244 probably benign Het
Pgm2l1 C T 7: 100,250,328 R50W probably damaging Het
Phkg1 T A 5: 129,865,923 K262N probably damaging Het
Pik3r4 A G 9: 105,644,511 E92G probably damaging Het
Prmt6 A T 3: 110,250,385 V196E possibly damaging Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Recql5 A T 11: 115,923,276 S348T probably damaging Het
Rfk T G 19: 17,398,682 probably null Het
Selenbp1 A T 3: 94,944,102 M389L probably benign Het
Sipa1l2 G A 8: 125,492,290 R103C probably benign Het
Slc10a6 T A 5: 103,629,190 S15C probably damaging Het
Slc12a2 G T 18: 57,932,524 V944L probably benign Het
Slc16a11 T A 11: 70,215,317 L127Q possibly damaging Het
St6gal1 A G 16: 23,356,228 Y272C probably damaging Het
Stab2 C A 10: 86,981,135 V133F probably benign Het
Stradb G A 1: 58,992,726 V266I probably damaging Het
Tmem150b A G 7: 4,720,759 W140R probably benign Het
Tnnt3 A T 7: 142,512,096 K157* probably null Het
Trove2 T C 1: 143,770,873 T45A probably damaging Het
Ttn T G 2: 76,723,769 K30863N probably damaging Het
Vldlr G A 19: 27,243,136 R592H probably benign Het
Vmn1r12 A T 6: 57,158,898 probably benign Het
Vmn2r63 A C 7: 42,925,269 S519R probably damaging Het
Zbtb22 G C 17: 33,918,497 E539Q probably damaging Het
Zbtb44 G A 9: 31,054,079 A262T probably benign Het
Zfp280d A T 9: 72,324,072 N455I probably damaging Het
Zfp287 T C 11: 62,725,263 N201D probably damaging Het
Zfp988 T C 4: 147,332,294 L395P probably damaging Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
BB001:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R1749:Ptprn2 UTSW 12 116580428 missense probably benign 0.00
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116722133 missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116824396 missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117233365 splice site probably null
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117211862 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116858951 missense probably benign
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116485866 start codon destroyed probably null
R7666:Ptprn2 UTSW 12 116841320 missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117184737 missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117255548 missense possibly damaging 0.73
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- ACAGTGCACATTTCTGGGTG -3'
(R):5'- TCCTGAGTCCACACATCTAATGC -3'

Sequencing Primer
(F):5'- GTTTCTTCTGAGTTACAGTGCTC -3'
(R):5'- GCAAAGCCTTTCTTACTACAGG -3'
Posted On2019-11-12