Incidental Mutation 'R7658:Nsd1'
ID 591385
Institutional Source Beutler Lab
Gene Symbol Nsd1
Ensembl Gene ENSMUSG00000021488
Gene Name nuclear receptor-binding SET-domain protein 1
Synonyms KMT3B
MMRRC Submission 045703-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7658 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 55209782-55318325 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55277639 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 1536 (R1536S)
Ref Sequence ENSEMBL: ENSMUSP00000097089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099490] [ENSMUST00000224973]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000099490
AA Change: R1536S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488
AA Change: R1536S

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224973
AA Change: R1433S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a SET domain, 2 LXXLL motifs, 3 nuclear translocation signals (NLSs), 4 plant homeodomain (PHD) finger regions, and a proline-rich region. The encoded protein enhances androgen receptor (AR) transactivation, and this enhancement can be increased further in the presence of other androgen receptor associated coregulators. This protein may act as a nucleus-localized, basic transcriptional factor and also as a bifunctional transcriptional regulator. Mutations of this gene have been associated with Sotos syndrome and Weaver syndrome. One version of childhood acute myeloid leukemia is the result of a cryptic translocation with the breakpoints occurring within nuclear receptor-binding Su-var, enhancer of zeste, and trithorax domain protein 1 on chromosome 5 and nucleoporin, 98-kd on chromosome 11. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit excess apoptosis and retarded growth, fail to complete gastrulation, and are resorbed by embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 89,063,730 S72Y unknown Het
6430531B16Rik T C 7: 139,976,618 N152S probably benign Het
Abca8b T A 11: 109,935,717 K1568N probably benign Het
Adcy6 T A 15: 98,596,067 Y865F probably benign Het
Adgrf3 A T 5: 30,197,206 V608D probably benign Het
Agbl1 G T 7: 76,766,369 A965S unknown Het
Agbl3 C T 6: 34,832,508 P690L probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amt A C 9: 108,297,231 H65P probably damaging Het
Ankrd11 T A 8: 122,893,664 T1150S probably benign Het
Arhgap15 A C 2: 44,142,268 H288P probably benign Het
Arhgap39 A T 15: 76,737,417 M328K probably benign Het
Arhgef12 T C 9: 42,992,536 K743R probably damaging Het
Atg2a T G 19: 6,251,263 V789G probably damaging Het
Ccdc54 T C 16: 50,590,481 T141A probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh5 T C 8: 104,129,401 probably null Het
Cdkl3 T C 11: 52,027,182 V404A not run Het
Chrm2 A T 6: 36,523,249 I14F probably benign Het
Cnbp T C 6: 87,845,276 K89E possibly damaging Het
Cntn6 T A 6: 104,650,483 D92E probably benign Het
Col15a1 T C 4: 47,245,591 F114S possibly damaging Het
Csrnp1 A G 9: 119,972,403 F530S probably benign Het
Dcun1d3 C T 7: 119,857,668 V274M probably damaging Het
Dph2 T A 4: 117,890,281 H302L possibly damaging Het
Fam162a A T 16: 36,046,400 Y118* probably null Het
Fam186a A G 15: 99,939,844 Y2840H unknown Het
Fto A G 8: 91,666,322 K466E probably benign Het
Gal T A 19: 3,413,309 Y41F probably damaging Het
Gigyf2 A T 1: 87,419,138 L620F unknown Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Glud1 A T 14: 34,311,157 E87V probably benign Het
Gm21190 T G 5: 15,527,925 E94A possibly damaging Het
Gm5592 T C 7: 41,288,710 V472A probably benign Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gpn2 A G 4: 133,591,376 E304G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Gucy2e G A 11: 69,226,229 Q789* probably null Het
Gxylt2 T A 6: 100,783,143 V213E probably damaging Het
Ighv1-75 G A 12: 115,834,111 L64F possibly damaging Het
Il17re T C 6: 113,458,982 C30R probably benign Het
Il7 G T 3: 7,604,082 D31E probably benign Het
Ints4 T C 7: 97,529,253 Y687H possibly damaging Het
Kdelr1 T G 7: 45,882,977 V202G probably benign Het
Khnyn C A 14: 55,887,139 Y283* probably null Het
Klf11 T C 12: 24,653,671 V52A probably damaging Het
Klhl7 A G 5: 24,141,286 N310S probably benign Het
Krt27 A T 11: 99,349,486 L202Q possibly damaging Het
Lce1d A G 3: 92,686,047 C20R unknown Het
Lim2 A T 7: 43,433,630 I80F possibly damaging Het
Lrrk2 T A 15: 91,700,358 F326Y possibly damaging Het
Lyst A T 13: 13,730,476 Y3246F possibly damaging Het
Mafb T A 2: 160,366,435 H81L possibly damaging Het
Mfsd5 G A 15: 102,280,877 R228H probably benign Het
Mmp1b A T 9: 7,386,675 F150I possibly damaging Het
Mthfd1 T A 12: 76,270,435 L20Q probably damaging Het
Mxra8 A G 4: 155,842,963 T402A probably benign Het
Ndc80 A T 17: 71,508,663 L376M probably damaging Het
Nup210l C A 3: 90,211,993 H1874Q probably benign Het
Nyap1 T C 5: 137,732,974 H776R probably benign Het
Patj C A 4: 98,688,179 H1773Q probably damaging Het
Pax8 T A 2: 24,436,511 T280S probably benign Het
Pcdhb19 A G 18: 37,498,981 T610A probably damaging Het
Pde2a A G 7: 101,511,581 D919G possibly damaging Het
Pdk2 T A 11: 95,028,965 Y240F probably damaging Het
Peg3 A T 7: 6,709,610 I871N probably damaging Het
Pex1 A T 5: 3,596,244 probably benign Het
Pgm2l1 C T 7: 100,250,328 R50W probably damaging Het
Phkg1 T A 5: 129,865,923 K262N probably damaging Het
Pik3r4 A G 9: 105,644,511 E92G probably damaging Het
Prmt6 A T 3: 110,250,385 V196E possibly damaging Het
Ptprn2 T G 12: 116,722,119 M66R probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Recql5 A T 11: 115,923,276 S348T probably damaging Het
Rfk T G 19: 17,398,682 probably null Het
Selenbp1 A T 3: 94,944,102 M389L probably benign Het
Sipa1l2 G A 8: 125,492,290 R103C probably benign Het
Slc10a6 T A 5: 103,629,190 S15C probably damaging Het
Slc12a2 G T 18: 57,932,524 V944L probably benign Het
Slc16a11 T A 11: 70,215,317 L127Q possibly damaging Het
St6gal1 A G 16: 23,356,228 Y272C probably damaging Het
Stab2 C A 10: 86,981,135 V133F probably benign Het
Stradb G A 1: 58,992,726 V266I probably damaging Het
Tmem150b A G 7: 4,720,759 W140R probably benign Het
Tnnt3 A T 7: 142,512,096 K157* probably null Het
Trove2 T C 1: 143,770,873 T45A probably damaging Het
Ttn T G 2: 76,723,769 K30863N probably damaging Het
Vldlr G A 19: 27,243,136 R592H probably benign Het
Vmn1r12 A T 6: 57,158,898 probably benign Het
Vmn2r63 A C 7: 42,925,269 S519R probably damaging Het
Zbtb22 G C 17: 33,918,497 E539Q probably damaging Het
Zbtb44 G A 9: 31,054,079 A262T probably benign Het
Zfp280d A T 9: 72,324,072 N455I probably damaging Het
Zfp287 T C 11: 62,725,263 N201D probably damaging Het
Zfp988 T C 4: 147,332,294 L395P probably damaging Het
Other mutations in Nsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Nsd1 APN 13 55238735 missense probably damaging 1.00
IGL01060:Nsd1 APN 13 55263429 missense probably damaging 1.00
IGL01125:Nsd1 APN 13 55245617 missense probably damaging 1.00
IGL01746:Nsd1 APN 13 55276515 splice site probably null
IGL02437:Nsd1 APN 13 55313441 missense probably damaging 1.00
IGL02530:Nsd1 APN 13 55302833 splice site probably benign
IGL02557:Nsd1 APN 13 55312448 missense probably damaging 1.00
IGL02572:Nsd1 APN 13 55296130 missense probably damaging 1.00
IGL02665:Nsd1 APN 13 55296183 missense probably damaging 1.00
IGL02870:Nsd1 APN 13 55313603 missense probably benign 0.06
IGL03181:Nsd1 APN 13 55247045 missense probably damaging 1.00
Amanuensis UTSW 13 55261626 nonsense probably null
handwriting UTSW 13 55313546 missense
Prothonotary UTSW 13 55282757 missense probably damaging 1.00
scribe UTSW 13 55291236 missense probably damaging 1.00
stenographer UTSW 13 55298376 splice site probably null
PIT4480001:Nsd1 UTSW 13 55213918 missense probably benign 0.11
R0316:Nsd1 UTSW 13 55213771 missense probably damaging 0.98
R0519:Nsd1 UTSW 13 55312835 missense probably benign 0.04
R0542:Nsd1 UTSW 13 55260458 missense possibly damaging 0.93
R0563:Nsd1 UTSW 13 55246578 missense possibly damaging 0.48
R0652:Nsd1 UTSW 13 55247586 missense possibly damaging 0.92
R0906:Nsd1 UTSW 13 55277590 missense probably benign 0.30
R1560:Nsd1 UTSW 13 55246720 nonsense probably null
R1572:Nsd1 UTSW 13 55246969 missense probably damaging 0.98
R1693:Nsd1 UTSW 13 55247261 missense probably benign
R1697:Nsd1 UTSW 13 55214059 critical splice acceptor site probably null
R1720:Nsd1 UTSW 13 55246898 missense probably damaging 0.98
R1829:Nsd1 UTSW 13 55246369 missense probably damaging 1.00
R1834:Nsd1 UTSW 13 55313351 missense possibly damaging 0.52
R1842:Nsd1 UTSW 13 55246445 missense probably damaging 1.00
R1880:Nsd1 UTSW 13 55213793 missense probably damaging 0.99
R2022:Nsd1 UTSW 13 55213279 missense probably damaging 0.99
R2075:Nsd1 UTSW 13 55310500 missense possibly damaging 0.74
R2143:Nsd1 UTSW 13 55260397 missense probably damaging 1.00
R2151:Nsd1 UTSW 13 55291236 missense probably damaging 1.00
R2316:Nsd1 UTSW 13 55233966 missense probably damaging 1.00
R2359:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2361:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R2656:Nsd1 UTSW 13 55246868 missense probably damaging 1.00
R2849:Nsd1 UTSW 13 55213692 missense probably damaging 0.99
R3237:Nsd1 UTSW 13 55312888 missense possibly damaging 0.92
R3772:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3773:Nsd1 UTSW 13 55246673 missense probably benign 0.00
R3849:Nsd1 UTSW 13 55246691 missense probably benign 0.00
R3951:Nsd1 UTSW 13 55268454 missense probably benign 0.05
R4036:Nsd1 UTSW 13 55213711 missense possibly damaging 0.90
R4073:Nsd1 UTSW 13 55247728 missense probably benign 0.28
R4080:Nsd1 UTSW 13 55301809 missense probably damaging 0.96
R4226:Nsd1 UTSW 13 55260401 missense probably damaging 1.00
R4485:Nsd1 UTSW 13 55245621 missense probably benign
R4703:Nsd1 UTSW 13 55214063 missense probably damaging 1.00
R4853:Nsd1 UTSW 13 55268504 missense probably benign 0.30
R4915:Nsd1 UTSW 13 55247868 missense possibly damaging 0.65
R4915:Nsd1 UTSW 13 55276528 missense probably benign 0.00
R5264:Nsd1 UTSW 13 55247346 missense possibly damaging 0.49
R5348:Nsd1 UTSW 13 55312334 missense probably benign 0.00
R5473:Nsd1 UTSW 13 55247772 missense probably damaging 1.00
R5498:Nsd1 UTSW 13 55213302 nonsense probably null
R5503:Nsd1 UTSW 13 55245939 missense probably damaging 1.00
R5511:Nsd1 UTSW 13 55312730 missense probably benign 0.00
R5683:Nsd1 UTSW 13 55246148 missense probably benign 0.00
R5778:Nsd1 UTSW 13 55306979 missense probably damaging 1.00
R5793:Nsd1 UTSW 13 55248006 missense probably benign
R5922:Nsd1 UTSW 13 55247475 missense probably benign 0.01
R5956:Nsd1 UTSW 13 55263404 missense probably damaging 1.00
R6053:Nsd1 UTSW 13 55293609 missense probably damaging 1.00
R6141:Nsd1 UTSW 13 55291284 missense probably damaging 1.00
R6158:Nsd1 UTSW 13 55245621 missense probably benign
R6224:Nsd1 UTSW 13 55313132 missense possibly damaging 0.85
R6396:Nsd1 UTSW 13 55238789 missense probably damaging 1.00
R6598:Nsd1 UTSW 13 55293702 missense possibly damaging 0.94
R7170:Nsd1 UTSW 13 55261626 nonsense probably null
R7205:Nsd1 UTSW 13 55246470 missense probably damaging 1.00
R7215:Nsd1 UTSW 13 55247641 missense probably benign 0.00
R7337:Nsd1 UTSW 13 55246209 missense probably damaging 1.00
R7432:Nsd1 UTSW 13 55213374 missense probably benign
R7638:Nsd1 UTSW 13 55312328 missense probably benign 0.01
R7647:Nsd1 UTSW 13 55299835 missense probably damaging 0.96
R7884:Nsd1 UTSW 13 55313255 missense probably damaging 0.99
R8032:Nsd1 UTSW 13 55310383 missense probably damaging 1.00
R8113:Nsd1 UTSW 13 55245621 missense probably benign
R8152:Nsd1 UTSW 13 55310367 missense possibly damaging 0.49
R8183:Nsd1 UTSW 13 55312373 missense probably damaging 1.00
R8432:Nsd1 UTSW 13 55247703 missense possibly damaging 0.91
R8462:Nsd1 UTSW 13 55298376 splice site probably null
R8469:Nsd1 UTSW 13 55277553 missense possibly damaging 0.76
R8756:Nsd1 UTSW 13 55313693 missense probably benign 0.00
R8867:Nsd1 UTSW 13 55282757 missense probably damaging 1.00
R9035:Nsd1 UTSW 13 55245854 missense possibly damaging 0.79
R9101:Nsd1 UTSW 13 55313546 missense
R9154:Nsd1 UTSW 13 55213440 missense probably damaging 1.00
R9155:Nsd1 UTSW 13 55213440 missense probably damaging 1.00
R9262:Nsd1 UTSW 13 55247058 missense possibly damaging 0.92
R9592:Nsd1 UTSW 13 55276542 missense probably damaging 1.00
R9604:Nsd1 UTSW 13 55233994 missense probably benign 0.25
R9712:Nsd1 UTSW 13 55246043 missense possibly damaging 0.81
R9716:Nsd1 UTSW 13 55310500 missense possibly damaging 0.74
R9787:Nsd1 UTSW 13 55313705 missense probably benign 0.15
Z1088:Nsd1 UTSW 13 55213848 missense possibly damaging 0.83
Z1176:Nsd1 UTSW 13 55245525 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCTGAACATCTGTAAGTGC -3'
(R):5'- AGCGATAAGATGGCCTTTAGGG -3'

Sequencing Primer
(F):5'- TGGTTAGACAAATAGCAGCCC -3'
(R):5'- GGCTCCTTAGGAATCATATGTGAGC -3'
Posted On 2019-11-12