Mutagenetix > Incidental Mutation

Incidental Mutation 'R7658:Rai14'

591389

Institutional Source

Beutler Lab

Gene Symbol

Rai14

Ensembl Gene

ENSMUSG00000022246

Gene Name

retinoic acid induced 14

Synonyms

1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg

MMRRC Submission

045703-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.537) question?

Stock #

R7658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

10568969-10714624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 10593103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 152 (G152R)

Ref Sequence

ENSEMBL: ENSMUSP00000087815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]

AlphaFold

Q9EP71

Predicted Effect

probably damaging
Transcript: ENSMUST00000090339
AA Change: G152R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: G152R

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000169385
AA Change: G152R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: G152R

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000227506
AA Change: G152R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7570

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	G	T	16: 89,063,730	S72Y	unknown	Het
6430531B16Rik	T	C	7: 139,976,618	N152S	probably benign	Het
Abca8b	T	A	11: 109,935,717	K1568N	probably benign	Het
Adcy6	T	A	15: 98,596,067	Y865F	probably benign	Het
Adgrf3	A	T	5: 30,197,206	V608D	probably benign	Het
Agbl1	G	T	7: 76,766,369	A965S	unknown	Het
Agbl3	C	T	6: 34,832,508	P690L	probably benign	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Amt	A	C	9: 108,297,231	H65P	probably damaging	Het
Ankrd11	T	A	8: 122,893,664	T1150S	probably benign	Het
Arhgap15	A	C	2: 44,142,268	H288P	probably benign	Het
Arhgap39	A	T	15: 76,737,417	M328K	probably benign	Het
Arhgef12	T	C	9: 42,992,536	K743R	probably damaging	Het
Atg2a	T	G	19: 6,251,263	V789G	probably damaging	Het
Ccdc54	T	C	16: 50,590,481	T141A	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdh5	T	C	8: 104,129,401		probably null	Het
Cdkl3	T	C	11: 52,027,182	V404A	not run	Het
Chrm2	A	T	6: 36,523,249	I14F	probably benign	Het
Cnbp	T	C	6: 87,845,276	K89E	possibly damaging	Het
Cntn6	T	A	6: 104,650,483	D92E	probably benign	Het
Col15a1	T	C	4: 47,245,591	F114S	possibly damaging	Het
Csrnp1	A	G	9: 119,972,403	F530S	probably benign	Het
Dcun1d3	C	T	7: 119,857,668	V274M	probably damaging	Het
Dph2	T	A	4: 117,890,281	H302L	possibly damaging	Het
Fam162a	A	T	16: 36,046,400	Y118*	probably null	Het
Fam186a	A	G	15: 99,939,844	Y2840H	unknown	Het
Fto	A	G	8: 91,666,322	K466E	probably benign	Het
Gal	T	A	19: 3,413,309	Y41F	probably damaging	Het
Gigyf2	A	T	1: 87,419,138	L620F	unknown	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Glud1	A	T	14: 34,311,157	E87V	probably benign	Het
Gm21190	T	G	5: 15,527,925	E94A	possibly damaging	Het
Gm5592	T	C	7: 41,288,710	V472A	probably benign	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gpn2	A	G	4: 133,591,376	E304G	probably benign	Het
Gsdmc2	T	C	15: 63,825,054	T423A	probably damaging	Het
Gucy2e	G	A	11: 69,226,229	Q789*	probably null	Het
Gxylt2	T	A	6: 100,783,143	V213E	probably damaging	Het
Ighv1-75	G	A	12: 115,834,111	L64F	possibly damaging	Het
Il17re	T	C	6: 113,458,982	C30R	probably benign	Het
Il7	G	T	3: 7,604,082	D31E	probably benign	Het
Ints4	T	C	7: 97,529,253	Y687H	possibly damaging	Het
Kdelr1	T	G	7: 45,882,977	V202G	probably benign	Het
Khnyn	C	A	14: 55,887,139	Y283*	probably null	Het
Klf11	T	C	12: 24,653,671	V52A	probably damaging	Het
Klhl7	A	G	5: 24,141,286	N310S	probably benign	Het
Krt27	A	T	11: 99,349,486	L202Q	possibly damaging	Het
Lce1d	A	G	3: 92,686,047	C20R	unknown	Het
Lim2	A	T	7: 43,433,630	I80F	possibly damaging	Het
Lrrk2	T	A	15: 91,700,358	F326Y	possibly damaging	Het
Lyst	A	T	13: 13,730,476	Y3246F	possibly damaging	Het
Mafb	T	A	2: 160,366,435	H81L	possibly damaging	Het
Mfsd5	G	A	15: 102,280,877	R228H	probably benign	Het
Mmp1b	A	T	9: 7,386,675	F150I	possibly damaging	Het
Mthfd1	T	A	12: 76,270,435	L20Q	probably damaging	Het
Mxra8	A	G	4: 155,842,963	T402A	probably benign	Het
Ndc80	A	T	17: 71,508,663	L376M	probably damaging	Het
Nsd1	A	T	13: 55,277,639	R1536S	probably damaging	Het
Nup210l	C	A	3: 90,211,993	H1874Q	probably benign	Het
Nyap1	T	C	5: 137,732,974	H776R	probably benign	Het
Patj	C	A	4: 98,688,179	H1773Q	probably damaging	Het
Pax8	T	A	2: 24,436,511	T280S	probably benign	Het
Pcdhb19	A	G	18: 37,498,981	T610A	probably damaging	Het
Pde2a	A	G	7: 101,511,581	D919G	possibly damaging	Het
Pdk2	T	A	11: 95,028,965	Y240F	probably damaging	Het
Peg3	A	T	7: 6,709,610	I871N	probably damaging	Het
Pex1	A	T	5: 3,596,244		probably benign	Het
Pgm2l1	C	T	7: 100,250,328	R50W	probably damaging	Het
Phkg1	T	A	5: 129,865,923	K262N	probably damaging	Het
Pik3r4	A	G	9: 105,644,511	E92G	probably damaging	Het
Prmt6	A	T	3: 110,250,385	V196E	possibly damaging	Het
Ptprn2	T	G	12: 116,722,119	M66R	probably benign	Het
Recql5	A	T	11: 115,923,276	S348T	probably damaging	Het
Rfk	T	G	19: 17,398,682		probably null	Het
Selenbp1	A	T	3: 94,944,102	M389L	probably benign	Het
Sipa1l2	G	A	8: 125,492,290	R103C	probably benign	Het
Slc10a6	T	A	5: 103,629,190	S15C	probably damaging	Het
Slc12a2	G	T	18: 57,932,524	V944L	probably benign	Het
Slc16a11	T	A	11: 70,215,317	L127Q	possibly damaging	Het
St6gal1	A	G	16: 23,356,228	Y272C	probably damaging	Het
Stab2	C	A	10: 86,981,135	V133F	probably benign	Het
Stradb	G	A	1: 58,992,726	V266I	probably damaging	Het
Tmem150b	A	G	7: 4,720,759	W140R	probably benign	Het
Tnnt3	A	T	7: 142,512,096	K157*	probably null	Het
Trove2	T	C	1: 143,770,873	T45A	probably damaging	Het
Ttn	T	G	2: 76,723,769	K30863N	probably damaging	Het
Vldlr	G	A	19: 27,243,136	R592H	probably benign	Het
Vmn1r12	A	T	6: 57,158,898		probably benign	Het
Vmn2r63	A	C	7: 42,925,269	S519R	probably damaging	Het
Zbtb22	G	C	17: 33,918,497	E539Q	probably damaging	Het
Zbtb44	G	A	9: 31,054,079	A262T	probably benign	Het
Zfp280d	A	T	9: 72,324,072	N455I	probably damaging	Het
Zfp287	T	C	11: 62,725,263	N201D	probably damaging	Het
Zfp988	T	C	4: 147,332,294	L395P	probably damaging	Het

Other mutations in Rai14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Rai14	APN	15	10599711	splice site	probably benign
IGL01625:Rai14	APN	15	10572374	missense	probably benign	0.30
IGL01925:Rai14	APN	15	10595862	missense	possibly damaging	0.88
IGL02053:Rai14	APN	15	10633156	missense	probably benign	0.00
IGL02531:Rai14	APN	15	10574782	missense	probably damaging	1.00
IGL02748:Rai14	APN	15	10589335	missense	probably benign	0.14
IGL02945:Rai14	APN	15	10574709	missense	probably benign	0.00
PIT4618001:Rai14	UTSW	15	10575156	missense	probably damaging	1.00
R1400:Rai14	UTSW	15	10571548	missense	probably damaging	0.98
R1583:Rai14	UTSW	15	10587916	missense	probably damaging	1.00
R1686:Rai14	UTSW	15	10592196	missense	probably damaging	0.98
R1721:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1867:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1868:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1998:Rai14	UTSW	15	10594981	splice site	probably null
R2118:Rai14	UTSW	15	10575166	missense	probably benign	0.00
R3161:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R4049:Rai14	UTSW	15	10592212	missense	probably benign	0.30
R4611:Rai14	UTSW	15	10592138	missense	probably damaging	1.00
R4760:Rai14	UTSW	15	10575690	missense	possibly damaging	0.60
R4863:Rai14	UTSW	15	10572470	missense	probably damaging	0.99
R5022:Rai14	UTSW	15	10574506	missense	probably damaging	0.96
R5110:Rai14	UTSW	15	10690410	start gained	probably benign
R5410:Rai14	UTSW	15	10574938	missense	probably damaging	1.00
R5643:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5644:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5681:Rai14	UTSW	15	10575120	missense	probably damaging	1.00
R5934:Rai14	UTSW	15	10575159	missense	probably damaging	0.98
R6333:Rai14	UTSW	15	10574936	nonsense	probably null
R6338:Rai14	UTSW	15	10574976	missense	probably damaging	1.00
R6864:Rai14	UTSW	15	10633168	missense	possibly damaging	0.95
R7015:Rai14	UTSW	15	10589315	nonsense	probably null
R7155:Rai14	UTSW	15	10595003	missense	possibly damaging	0.53
R7480:Rai14	UTSW	15	10571536	missense	probably benign	0.02
R7574:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7578:Rai14	UTSW	15	10574828	missense	probably benign
R7578:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7597:Rai14	UTSW	15	10574851	missense	possibly damaging	0.94
R7779:Rai14	UTSW	15	10593026	missense	probably damaging	1.00
R7946:Rai14	UTSW	15	10574201	splice site	probably null
R8171:Rai14	UTSW	15	10633163	missense	probably damaging	1.00
R8195:Rai14	UTSW	15	10575216	missense	probably benign
R8471:Rai14	UTSW	15	10575159	missense	probably benign	0.01
R8485:Rai14	UTSW	15	10575036	missense	probably damaging	1.00
R9075:Rai14	UTSW	15	10589317	missense	probably damaging	1.00
R9287:Rai14	UTSW	15	10592118	missense	probably benign	0.14
R9502:Rai14	UTSW	15	10587861	missense	possibly damaging	0.50
R9603:Rai14	UTSW	15	10595030	nonsense	probably null
R9665:Rai14	UTSW	15	10574717	missense	probably damaging	1.00
R9767:Rai14	UTSW	15	10610041	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGACCCTCAATTACCAGGAAGG -3'
(R):5'- CAGCTAAAAGTCGGGAGATTGC -3'

Sequencing Primer
(F):5'- GGTAGAATGATAAAAAGCAAACCAC -3'
(R):5'- TTGCAAAAGACGTATGCTCAAGTG -3'

Posted On

2019-11-12