Mutagenetix > Incidental Mutations

Incidental Mutation 'R7658:Adcy6'

591393

Institutional Source

Beutler Lab

Gene Symbol

Adcy6

Ensembl Gene

ENSMUSG00000022994

Gene Name

adenylate cyclase 6

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98589973-98610076 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 98596067 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 865 (Y865F)

Ref Sequence

ENSEMBL: ENSMUSP00000093939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096224] [ENSMUST00000228566] [ENSMUST00000228903]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000096224
AA Change: Y865F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000093939
Gene: ENSMUSG00000022994
AA Change: Y865F

Domain	Start	End	E-Value	Type
low complexity region	150	166	N/A	INTRINSIC
low complexity region	169	177	N/A	INTRINSIC
low complexity region	212	228	N/A	INTRINSIC
CYCc	331	532	2.95e-63	SMART
Pfam:DUF1053	580	669	3.5e-18	PFAM
transmembrane domain	701	723	N/A	INTRINSIC
transmembrane domain	744	763	N/A	INTRINSIC
transmembrane domain	815	834	N/A	INTRINSIC
transmembrane domain	839	861	N/A	INTRINSIC
Blast:CYCc	885	929	5e-20	BLAST
CYCc	939	1147	4.81e-45	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000228566
AA Change: Y863F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

probably benign
Transcript: ENSMUST00000228903

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylyl cyclase family of proteins, which are required for the synthesis of cyclic AMP. All members of this family have an intracellular N-terminus, a tandem repeat of six transmembrane domains separated by a cytoplasmic loop, and a C-terminal cytoplasmic domain. The two cytoplasmic regions bind ATP and form the catalytic core of the protein. Adenylyl cyclases are important effectors of transmembrane signaling pathways and are regulated by the activity of G protein coupled receptor signaling. This protein belongs to a small subclass of adenylyl cyclase proteins that are functionally related and are inhibited by protein kinase A, calcium ions and nitric oxide. A mutation in this gene is associated with arthrogryposis multiplex congenita. [provided by RefSeq, May 2015]
PHENOTYPE: Mice homozygous for disruption of this gene show a reduction in calcium uptake and transport in cardiomyocytes as well as mild functional abnormalities in the left ventricle. Mice homozygous for a conditional allele activated in collecting ducts exhibit decreased urine osmilality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	G	T	16: 89,063,730	S72Y	unknown	Het
6430531B16Rik	T	C	7: 139,976,618	N152S	probably benign	Het
Abca8b	T	A	11: 109,935,717	K1568N	probably benign	Het
Adgrf3	A	T	5: 30,197,206	V608D	probably benign	Het
Agbl1	G	T	7: 76,766,369	A965S	unknown	Het
Agbl3	C	T	6: 34,832,508	P690L	probably benign	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Amt	A	C	9: 108,297,231	H65P	probably damaging	Het
Ankrd11	T	A	8: 122,893,664	T1150S	probably benign	Het
Arhgap15	A	C	2: 44,142,268	H288P	probably benign	Het
Arhgap39	A	T	15: 76,737,417	M328K	probably benign	Het
Arhgef12	T	C	9: 42,992,536	K743R	probably damaging	Het
Atg2a	T	G	19: 6,251,263	V789G	probably damaging	Het
Ccdc54	T	C	16: 50,590,481	T141A	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdh5	T	C	8: 104,129,401		probably null	Het
Cdkl3	T	C	11: 52,027,182	V404A	not run	Het
Chrm2	A	T	6: 36,523,249	I14F	probably benign	Het
Cnbp	T	C	6: 87,845,276	K89E	possibly damaging	Het
Cntn6	T	A	6: 104,650,483	D92E	probably benign	Het
Col15a1	T	C	4: 47,245,591	F114S	possibly damaging	Het
Csrnp1	A	G	9: 119,972,403	F530S	probably benign	Het
Dcun1d3	C	T	7: 119,857,668	V274M	probably damaging	Het
Dph2	T	A	4: 117,890,281	H302L	possibly damaging	Het
Fam162a	A	T	16: 36,046,400	Y118*	probably null	Het
Fam186a	A	G	15: 99,939,844	Y2840H	unknown	Het
Fto	A	G	8: 91,666,322	K466E	probably benign	Het
Gal	T	A	19: 3,413,309	Y41F	probably damaging	Het
Gigyf2	A	T	1: 87,419,138	L620F	unknown	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Glud1	A	T	14: 34,311,157	E87V	probably benign	Het
Gm21190	T	G	5: 15,527,925	E94A	possibly damaging	Het
Gm5592	T	C	7: 41,288,710	V472A	probably benign	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gpn2	A	G	4: 133,591,376	E304G	probably benign	Het
Gsdmc2	T	C	15: 63,825,054	T423A	probably damaging	Het
Gucy2e	G	A	11: 69,226,229	Q789*	probably null	Het
Gxylt2	T	A	6: 100,783,143	V213E	probably damaging	Het
Ighv1-75	G	A	12: 115,834,111	L64F	possibly damaging	Het
Il17re	T	C	6: 113,458,982	C30R	probably benign	Het
Il7	G	T	3: 7,604,082	D31E	probably benign	Het
Ints4	T	C	7: 97,529,253	Y687H	possibly damaging	Het
Kdelr1	T	G	7: 45,882,977	V202G	probably benign	Het
Khnyn	C	A	14: 55,887,139	Y283*	probably null	Het
Klf11	T	C	12: 24,653,671	V52A	probably damaging	Het
Klhl7	A	G	5: 24,141,286	N310S	probably benign	Het
Krt27	A	T	11: 99,349,486	L202Q	possibly damaging	Het
Lce1d	A	G	3: 92,686,047	C20R	unknown	Het
Lim2	A	T	7: 43,433,630	I80F	possibly damaging	Het
Lrrk2	T	A	15: 91,700,358	F326Y	possibly damaging	Het
Lyst	A	T	13: 13,730,476	Y3246F	possibly damaging	Het
Mafb	T	A	2: 160,366,435	H81L	possibly damaging	Het
Mfsd5	G	A	15: 102,280,877	R228H	probably benign	Het
Mmp1b	A	T	9: 7,386,675	F150I	possibly damaging	Het
Mthfd1	T	A	12: 76,270,435	L20Q	probably damaging	Het
Mxra8	A	G	4: 155,842,963	T402A	probably benign	Het
Ndc80	A	T	17: 71,508,663	L376M	probably damaging	Het
Nsd1	A	T	13: 55,277,639	R1536S	probably damaging	Het
Nup210l	C	A	3: 90,211,993	H1874Q	probably benign	Het
Nyap1	T	C	5: 137,732,974	H776R	probably benign	Het
Patj	C	A	4: 98,688,179	H1773Q	probably damaging	Het
Pax8	T	A	2: 24,436,511	T280S	probably benign	Het
Pcdhb19	A	G	18: 37,498,981	T610A	probably damaging	Het
Pde2a	A	G	7: 101,511,581	D919G	possibly damaging	Het
Pdk2	T	A	11: 95,028,965	Y240F	probably damaging	Het
Peg3	A	T	7: 6,709,610	I871N	probably damaging	Het
Pex1	A	T	5: 3,596,244		probably benign	Het
Pgm2l1	C	T	7: 100,250,328	R50W	probably damaging	Het
Phkg1	T	A	5: 129,865,923	K262N	probably damaging	Het
Pik3r4	A	G	9: 105,644,511	E92G	probably damaging	Het
Prmt6	A	T	3: 110,250,385	V196E	possibly damaging	Het
Ptprn2	T	G	12: 116,722,119	M66R	probably benign	Het
Rai14	C	T	15: 10,593,103	G152R	probably damaging	Het
Recql5	A	T	11: 115,923,276	S348T	probably damaging	Het
Rfk	T	G	19: 17,398,682		probably null	Het
Selenbp1	A	T	3: 94,944,102	M389L	probably benign	Het
Sipa1l2	G	A	8: 125,492,290	R103C	probably benign	Het
Slc10a6	T	A	5: 103,629,190	S15C	probably damaging	Het
Slc12a2	G	T	18: 57,932,524	V944L	probably benign	Het
Slc16a11	T	A	11: 70,215,317	L127Q	possibly damaging	Het
St6gal1	A	G	16: 23,356,228	Y272C	probably damaging	Het
Stab2	C	A	10: 86,981,135	V133F	probably benign	Het
Stradb	G	A	1: 58,992,726	V266I	probably damaging	Het
Tmem150b	A	G	7: 4,720,759	W140R	probably benign	Het
Tnnt3	A	T	7: 142,512,096	K157*	probably null	Het
Trove2	T	C	1: 143,770,873	T45A	probably damaging	Het
Ttn	T	G	2: 76,723,769	K30863N	probably damaging	Het
Vldlr	G	A	19: 27,243,136	R592H	probably benign	Het
Vmn1r12	A	T	6: 57,158,898		probably benign	Het
Vmn2r63	A	C	7: 42,925,269	S519R	probably damaging	Het
Zbtb22	G	C	17: 33,918,497	E539Q	probably damaging	Het
Zbtb44	G	A	9: 31,054,079	A262T	probably benign	Het
Zfp280d	A	T	9: 72,324,072	N455I	probably damaging	Het
Zfp287	T	C	11: 62,725,263	N201D	probably damaging	Het
Zfp988	T	C	4: 147,332,294	L395P	probably damaging	Het

Other mutations in Adcy6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Adcy6	APN	15	98598976	missense	probably damaging	1.00
IGL01132:Adcy6	APN	15	98597851	missense	probably benign	0.14
IGL01642:Adcy6	APN	15	98594509	missense	possibly damaging	0.88
IGL01647:Adcy6	APN	15	98600275	missense	probably damaging	1.00
IGL01788:Adcy6	APN	15	98596519	nonsense	probably null
IGL02122:Adcy6	APN	15	98598882	missense	possibly damaging	0.66
IGL02210:Adcy6	APN	15	98594971	missense	possibly damaging	0.63
IGL02249:Adcy6	APN	15	98599914	missense	probably damaging	1.00
IGL02404:Adcy6	APN	15	98596938	missense	probably benign
IGL02691:Adcy6	APN	15	98604304	missense	probably damaging	1.00
PIT4515001:Adcy6	UTSW	15	98595146	missense	probably benign	0.04
R0178:Adcy6	UTSW	15	98604215	missense	probably benign	0.00
R0497:Adcy6	UTSW	15	98597725	critical splice donor site	probably null
R0739:Adcy6	UTSW	15	98598379	missense	probably benign	0.00
R1454:Adcy6	UTSW	15	98604728	missense	probably damaging	1.00
R1473:Adcy6	UTSW	15	98592743	missense	probably damaging	0.99
R1536:Adcy6	UTSW	15	98600007	missense	probably damaging	1.00
R1927:Adcy6	UTSW	15	98598498	splice site	probably null
R2178:Adcy6	UTSW	15	98594355	missense	probably damaging	1.00
R2294:Adcy6	UTSW	15	98597441	missense	possibly damaging	0.48
R2356:Adcy6	UTSW	15	98597016	splice site	probably null
R2898:Adcy6	UTSW	15	98593488	missense	probably damaging	1.00
R3001:Adcy6	UTSW	15	98596660	missense	probably benign	0.01
R3002:Adcy6	UTSW	15	98596660	missense	probably benign	0.01
R3794:Adcy6	UTSW	15	98598943	missense	probably damaging	1.00
R3884:Adcy6	UTSW	15	98597174	missense	probably benign	0.06
R4348:Adcy6	UTSW	15	98604160	missense	probably benign	0.44
R4351:Adcy6	UTSW	15	98604160	missense	probably benign	0.44
R4542:Adcy6	UTSW	15	98598988	missense	possibly damaging	0.70
R4548:Adcy6	UTSW	15	98598659	missense	probably damaging	1.00
R5693:Adcy6	UTSW	15	98603989	missense	probably damaging	1.00
R5707:Adcy6	UTSW	15	98598741	missense	probably damaging	1.00
R5994:Adcy6	UTSW	15	98593664	missense	probably damaging	1.00
R5998:Adcy6	UTSW	15	98594354	nonsense	probably null
R6142:Adcy6	UTSW	15	98598422	missense	probably benign
R6242:Adcy6	UTSW	15	98604015	nonsense	probably null
R6305:Adcy6	UTSW	15	98598645	missense	probably benign	0.13
R6751:Adcy6	UTSW	15	98596205	missense	probably benign
R7130:Adcy6	UTSW	15	98597229	missense	probably benign
R7335:Adcy6	UTSW	15	98603876	missense	probably benign	0.29
R7643:Adcy6	UTSW	15	98593568	missense	probably benign
R7748:Adcy6	UTSW	15	98604556	missense	probably benign	0.01
R7761:Adcy6	UTSW	15	98600014	missense	probably damaging	1.00
R7774:Adcy6	UTSW	15	98596533	missense	probably benign
R7954:Adcy6	UTSW	15	98596892	critical splice donor site	probably null
R8259:Adcy6	UTSW	15	98601038	missense	probably damaging	0.97
R8260:Adcy6	UTSW	15	98601038	missense	probably damaging	0.97
R8520:Adcy6	UTSW	15	98604160	missense	probably benign
R8790:Adcy6	UTSW	15	98599000	missense	probably damaging	1.00
R8834:Adcy6	UTSW	15	98601041	missense	possibly damaging	0.94
R8951:Adcy6	UTSW	15	98604259	missense	possibly damaging	0.95
R9297:Adcy6	UTSW	15	98593585	missense	possibly damaging	0.91
R9318:Adcy6	UTSW	15	98593585	missense	possibly damaging	0.91
X0020:Adcy6	UTSW	15	98598735	missense	probably damaging	0.99
X0021:Adcy6	UTSW	15	98603942	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GCCACATTCCAGGAACTAGC -3'
(R):5'- CATGGATTGTACAGGGAGCTG -3'

Sequencing Primer
(F):5'- ATTCCAGGAACTAGCCCTTCC -3'
(R):5'- AGTAGGGCTCTTCCTGCTCTG -3'

Posted On

2019-11-12