Incidental Mutation 'R7658:Fam186a'
ID 591394
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Name family with sequence similarity 186, member A
Synonyms LOC380973, 1700030F18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R7658 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99918348-99967061 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99939844 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 2840 (Y2840H)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000100209
AA Change: Y2840H
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: Y2840H

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 89,063,730 S72Y unknown Het
6430531B16Rik T C 7: 139,976,618 N152S probably benign Het
Abca8b T A 11: 109,935,717 K1568N probably benign Het
Adcy6 T A 15: 98,596,067 Y865F probably benign Het
Adgrf3 A T 5: 30,197,206 V608D probably benign Het
Agbl1 G T 7: 76,766,369 A965S unknown Het
Agbl3 C T 6: 34,832,508 P690L probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amt A C 9: 108,297,231 H65P probably damaging Het
Ankrd11 T A 8: 122,893,664 T1150S probably benign Het
Arhgap15 A C 2: 44,142,268 H288P probably benign Het
Arhgap39 A T 15: 76,737,417 M328K probably benign Het
Arhgef12 T C 9: 42,992,536 K743R probably damaging Het
Atg2a T G 19: 6,251,263 V789G probably damaging Het
Ccdc54 T C 16: 50,590,481 T141A probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh5 T C 8: 104,129,401 probably null Het
Cdkl3 T C 11: 52,027,182 V404A not run Het
Chrm2 A T 6: 36,523,249 I14F probably benign Het
Cnbp T C 6: 87,845,276 K89E possibly damaging Het
Cntn6 T A 6: 104,650,483 D92E probably benign Het
Col15a1 T C 4: 47,245,591 F114S possibly damaging Het
Csrnp1 A G 9: 119,972,403 F530S probably benign Het
Dcun1d3 C T 7: 119,857,668 V274M probably damaging Het
Dph2 T A 4: 117,890,281 H302L possibly damaging Het
Fam162a A T 16: 36,046,400 Y118* probably null Het
Fto A G 8: 91,666,322 K466E probably benign Het
Gal T A 19: 3,413,309 Y41F probably damaging Het
Gigyf2 A T 1: 87,419,138 L620F unknown Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Glud1 A T 14: 34,311,157 E87V probably benign Het
Gm21190 T G 5: 15,527,925 E94A possibly damaging Het
Gm5592 T C 7: 41,288,710 V472A probably benign Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gpn2 A G 4: 133,591,376 E304G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Gucy2e G A 11: 69,226,229 Q789* probably null Het
Gxylt2 T A 6: 100,783,143 V213E probably damaging Het
Ighv1-75 G A 12: 115,834,111 L64F possibly damaging Het
Il17re T C 6: 113,458,982 C30R probably benign Het
Il7 G T 3: 7,604,082 D31E probably benign Het
Ints4 T C 7: 97,529,253 Y687H possibly damaging Het
Kdelr1 T G 7: 45,882,977 V202G probably benign Het
Khnyn C A 14: 55,887,139 Y283* probably null Het
Klf11 T C 12: 24,653,671 V52A probably damaging Het
Klhl7 A G 5: 24,141,286 N310S probably benign Het
Krt27 A T 11: 99,349,486 L202Q possibly damaging Het
Lce1d A G 3: 92,686,047 C20R unknown Het
Lim2 A T 7: 43,433,630 I80F possibly damaging Het
Lrrk2 T A 15: 91,700,358 F326Y possibly damaging Het
Lyst A T 13: 13,730,476 Y3246F possibly damaging Het
Mafb T A 2: 160,366,435 H81L possibly damaging Het
Mfsd5 G A 15: 102,280,877 R228H probably benign Het
Mmp1b A T 9: 7,386,675 F150I possibly damaging Het
Mthfd1 T A 12: 76,270,435 L20Q probably damaging Het
Mxra8 A G 4: 155,842,963 T402A probably benign Het
Ndc80 A T 17: 71,508,663 L376M probably damaging Het
Nsd1 A T 13: 55,277,639 R1536S probably damaging Het
Nup210l C A 3: 90,211,993 H1874Q probably benign Het
Nyap1 T C 5: 137,732,974 H776R probably benign Het
Patj C A 4: 98,688,179 H1773Q probably damaging Het
Pax8 T A 2: 24,436,511 T280S probably benign Het
Pcdhb19 A G 18: 37,498,981 T610A probably damaging Het
Pde2a A G 7: 101,511,581 D919G possibly damaging Het
Pdk2 T A 11: 95,028,965 Y240F probably damaging Het
Peg3 A T 7: 6,709,610 I871N probably damaging Het
Pex1 A T 5: 3,596,244 probably benign Het
Pgm2l1 C T 7: 100,250,328 R50W probably damaging Het
Phkg1 T A 5: 129,865,923 K262N probably damaging Het
Pik3r4 A G 9: 105,644,511 E92G probably damaging Het
Prmt6 A T 3: 110,250,385 V196E possibly damaging Het
Ptprn2 T G 12: 116,722,119 M66R probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Recql5 A T 11: 115,923,276 S348T probably damaging Het
Rfk T G 19: 17,398,682 probably null Het
Selenbp1 A T 3: 94,944,102 M389L probably benign Het
Sipa1l2 G A 8: 125,492,290 R103C probably benign Het
Slc10a6 T A 5: 103,629,190 S15C probably damaging Het
Slc12a2 G T 18: 57,932,524 V944L probably benign Het
Slc16a11 T A 11: 70,215,317 L127Q possibly damaging Het
St6gal1 A G 16: 23,356,228 Y272C probably damaging Het
Stab2 C A 10: 86,981,135 V133F probably benign Het
Stradb G A 1: 58,992,726 V266I probably damaging Het
Tmem150b A G 7: 4,720,759 W140R probably benign Het
Tnnt3 A T 7: 142,512,096 K157* probably null Het
Trove2 T C 1: 143,770,873 T45A probably damaging Het
Ttn T G 2: 76,723,769 K30863N probably damaging Het
Vldlr G A 19: 27,243,136 R592H probably benign Het
Vmn1r12 A T 6: 57,158,898 probably benign Het
Vmn2r63 A C 7: 42,925,269 S519R probably damaging Het
Zbtb22 G C 17: 33,918,497 E539Q probably damaging Het
Zbtb44 G A 9: 31,054,079 A262T probably benign Het
Zfp280d A T 9: 72,324,072 N455I probably damaging Het
Zfp287 T C 11: 62,725,263 N201D probably damaging Het
Zfp988 T C 4: 147,332,294 L395P probably damaging Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99927691 splice site probably benign
IGL03047:Fam186a UTSW 15 99945708 missense unknown
R0172:Fam186a UTSW 15 99954887 missense unknown
R0194:Fam186a UTSW 15 99941763 missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99942174 missense probably damaging 0.97
R0799:Fam186a UTSW 15 99942012 missense probably damaging 1.00
R1295:Fam186a UTSW 15 99939789 splice site probably benign
R1366:Fam186a UTSW 15 99943389 missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99947655 missense unknown
R1592:Fam186a UTSW 15 99940318 missense probably benign 0.01
R1636:Fam186a UTSW 15 99941658 missense unknown
R1719:Fam186a UTSW 15 99942346 missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99966881 nonsense probably null
R1856:Fam186a UTSW 15 99940302 missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99933676 unclassified probably benign
R2192:Fam186a UTSW 15 99940311 missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99954864 missense unknown
R2251:Fam186a UTSW 15 99945097 missense probably benign 0.02
R2902:Fam186a UTSW 15 99945168 missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99943794 missense probably damaging 0.99
R3744:Fam186a UTSW 15 99947535 missense unknown
R4021:Fam186a UTSW 15 99941799 missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99933685 unclassified probably benign
R4238:Fam186a UTSW 15 99943642 missense probably benign 0.05
R4667:Fam186a UTSW 15 99944532 missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99933538 unclassified probably benign
R4835:Fam186a UTSW 15 99945808 missense unknown
R4837:Fam186a UTSW 15 99940797 missense unknown
R4897:Fam186a UTSW 15 99945277 missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99946842 missense unknown
R4950:Fam186a UTSW 15 99941653 missense unknown
R4995:Fam186a UTSW 15 99945099 missense probably benign 0.27
R5062:Fam186a UTSW 15 99944646 missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99943096 missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99955493 missense unknown
R5424:Fam186a UTSW 15 99945763 missense unknown
R5624:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99947050 missense unknown
R5652:Fam186a UTSW 15 99945372 missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99966824 nonsense probably null
R5965:Fam186a UTSW 15 99945097 missense probably benign 0.37
R6044:Fam186a UTSW 15 99941997 missense probably damaging 0.97
R6077:Fam186a UTSW 15 99942703 missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99940363 missense probably benign 0.00
R6185:Fam186a UTSW 15 99947649 missense unknown
R6186:Fam186a UTSW 15 99947325 missense unknown
R6242:Fam186a UTSW 15 99939907 missense unknown
R6351:Fam186a UTSW 15 99941742 missense probably damaging 0.97
R6368:Fam186a UTSW 15 99943317 missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99947331 missense unknown
R6559:Fam186a UTSW 15 99944475 missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99954875 missense unknown
R6867:Fam186a UTSW 15 99945850 missense unknown
R6957:Fam186a UTSW 15 99946476 missense unknown
R6961:Fam186a UTSW 15 99940201 missense probably benign 0.16
R6994:Fam186a UTSW 15 99942466 missense probably benign 0.35
R6996:Fam186a UTSW 15 99955493 missense unknown
R7062:Fam186a UTSW 15 99933640 unclassified probably benign
R7064:Fam186a UTSW 15 99941676 missense unknown
R7173:Fam186a UTSW 15 99945650 missense unknown
R7244:Fam186a UTSW 15 99946392 missense unknown
R7270:Fam186a UTSW 15 99944152 missense possibly damaging 0.66
R7410:Fam186a UTSW 15 99946945 nonsense probably null
R7437:Fam186a UTSW 15 99942894 missense probably damaging 1.00
R7475:Fam186a UTSW 15 99947514 missense unknown
R7487:Fam186a UTSW 15 99942136 missense possibly damaging 0.66
R7526:Fam186a UTSW 15 99941915 missense possibly damaging 0.83
R7650:Fam186a UTSW 15 99939907 missense unknown
R7663:Fam186a UTSW 15 99945069 missense probably benign 0.00
R7703:Fam186a UTSW 15 99954797 missense unknown
R7814:Fam186a UTSW 15 99944664 missense possibly damaging 0.92
R7958:Fam186a UTSW 15 99943308 missense probably damaging 0.99
R7970:Fam186a UTSW 15 99933586 missense unknown
R8076:Fam186a UTSW 15 99943470 missense possibly damaging 0.83
R8087:Fam186a UTSW 15 99941844 missense possibly damaging 0.46
R8130:Fam186a UTSW 15 99944033 frame shift probably null
R8239:Fam186a UTSW 15 99941310 missense unknown
R8246:Fam186a UTSW 15 99940547 missense unknown
R8446:Fam186a UTSW 15 99947454 missense unknown
R8469:Fam186a UTSW 15 99947305 missense unknown
R8676:Fam186a UTSW 15 99947142 missense unknown
R8790:Fam186a UTSW 15 99943143 missense possibly damaging 0.90
R8808:Fam186a UTSW 15 99944723 missense possibly damaging 0.83
R8848:Fam186a UTSW 15 99940153 missense possibly damaging 0.83
R9083:Fam186a UTSW 15 99945198 missense probably benign 0.27
R9106:Fam186a UTSW 15 99946226 small deletion probably benign
R9116:Fam186a UTSW 15 99942591 missense possibly damaging 0.95
R9156:Fam186a UTSW 15 99943278 missense possibly damaging 0.46
R9227:Fam186a UTSW 15 99955503 missense unknown
R9250:Fam186a UTSW 15 99947449 missense unknown
R9282:Fam186a UTSW 15 99941998 missense probably damaging 0.97
X0021:Fam186a UTSW 15 99945435 missense probably benign 0.00
Z1088:Fam186a UTSW 15 99945994 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCTTCATAAGAGCATGATACAGC -3'
(R):5'- GCCAAGATGATAGTGTCCCC -3'

Sequencing Primer
(F):5'- GGAGATCCAATATCCTCTGTGAGC -3'
(R):5'- GTGTCCCCCACTGATCAGCAC -3'
Posted On 2019-11-12