Incidental Mutation 'R7658:Pcdhb19'
ID591402
Institutional Source Beutler Lab
Gene Symbol Pcdhb19
Ensembl Gene ENSMUSG00000043313
Gene Nameprotocadherin beta 19
SynonymsPcdhbS, Pcdhb11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7658 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37496991-37504128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37498981 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 610 (T610A)
Ref Sequence ENSEMBL: ENSMUSP00000053326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055949] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000055949
SMART Domains Protein: ENSMUSP00000052113
Gene: ENSMUSG00000048347

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Cadherin_2 30 112 3.1e-34 PFAM
CA 155 240 7.97e-19 SMART
CA 264 345 6.27e-26 SMART
CA 368 449 2.63e-19 SMART
CA 473 559 7.09e-25 SMART
CA 589 670 2.87e-11 SMART
Pfam:Cadherin_C_2 687 771 7.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059571
AA Change: T610A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313
AA Change: T610A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 89,063,730 S72Y unknown Het
6430531B16Rik T C 7: 139,976,618 N152S probably benign Het
Abca8b T A 11: 109,935,717 K1568N probably benign Het
Adcy6 T A 15: 98,596,067 Y865F probably benign Het
Adgrf3 A T 5: 30,197,206 V608D probably benign Het
Agbl1 G T 7: 76,766,369 A965S unknown Het
Agbl3 C T 6: 34,832,508 P690L probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amt A C 9: 108,297,231 H65P probably damaging Het
Ankrd11 T A 8: 122,893,664 T1150S probably benign Het
Arhgap15 A C 2: 44,142,268 H288P probably benign Het
Arhgap39 A T 15: 76,737,417 M328K probably benign Het
Arhgef12 T C 9: 42,992,536 K743R probably damaging Het
Atg2a T G 19: 6,251,263 V789G probably damaging Het
Ccdc54 T C 16: 50,590,481 T141A probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh5 T C 8: 104,129,401 probably null Het
Cdkl3 T C 11: 52,027,182 V404A not run Het
Chrm2 A T 6: 36,523,249 I14F probably benign Het
Cnbp T C 6: 87,845,276 K89E possibly damaging Het
Cntn6 T A 6: 104,650,483 D92E probably benign Het
Col15a1 T C 4: 47,245,591 F114S possibly damaging Het
Csrnp1 A G 9: 119,972,403 F530S probably benign Het
Dcun1d3 C T 7: 119,857,668 V274M probably damaging Het
Dph2 T A 4: 117,890,281 H302L possibly damaging Het
Fam162a A T 16: 36,046,400 Y118* probably null Het
Fam186a A G 15: 99,939,844 Y2840H unknown Het
Fto A G 8: 91,666,322 K466E probably benign Het
Gal T A 19: 3,413,309 Y41F probably damaging Het
Gigyf2 A T 1: 87,419,138 L620F unknown Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Glud1 A T 14: 34,311,157 E87V probably benign Het
Gm21190 T G 5: 15,527,925 E94A possibly damaging Het
Gm5592 T C 7: 41,288,710 V472A probably benign Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gpn2 A G 4: 133,591,376 E304G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Gucy2e G A 11: 69,226,229 Q789* probably null Het
Gxylt2 T A 6: 100,783,143 V213E probably damaging Het
Ighv1-75 G A 12: 115,834,111 L64F possibly damaging Het
Il17re T C 6: 113,458,982 C30R probably benign Het
Il7 G T 3: 7,604,082 D31E probably benign Het
Ints4 T C 7: 97,529,253 Y687H possibly damaging Het
Kdelr1 T G 7: 45,882,977 V202G probably benign Het
Khnyn C A 14: 55,887,139 Y283* probably null Het
Klf11 T C 12: 24,653,671 V52A probably damaging Het
Klhl7 A G 5: 24,141,286 N310S probably benign Het
Krt27 A T 11: 99,349,486 L202Q possibly damaging Het
Lce1d A G 3: 92,686,047 C20R unknown Het
Lim2 A T 7: 43,433,630 I80F possibly damaging Het
Lrrk2 T A 15: 91,700,358 F326Y possibly damaging Het
Lyst A T 13: 13,730,476 Y3246F possibly damaging Het
Mafb T A 2: 160,366,435 H81L possibly damaging Het
Mfsd5 G A 15: 102,280,877 R228H probably benign Het
Mmp1b A T 9: 7,386,675 F150I possibly damaging Het
Mthfd1 T A 12: 76,270,435 L20Q probably damaging Het
Mxra8 A G 4: 155,842,963 T402A probably benign Het
Ndc80 A T 17: 71,508,663 L376M probably damaging Het
Nsd1 A T 13: 55,277,639 R1536S probably damaging Het
Nup210l C A 3: 90,211,993 H1874Q probably benign Het
Nyap1 T C 5: 137,732,974 H776R probably benign Het
Patj C A 4: 98,688,179 H1773Q probably damaging Het
Pax8 T A 2: 24,436,511 T280S probably benign Het
Pde2a A G 7: 101,511,581 D919G possibly damaging Het
Pdk2 T A 11: 95,028,965 Y240F probably damaging Het
Peg3 A T 7: 6,709,610 I871N probably damaging Het
Pex1 A T 5: 3,596,244 probably benign Het
Pgm2l1 C T 7: 100,250,328 R50W probably damaging Het
Phkg1 T A 5: 129,865,923 K262N probably damaging Het
Pik3r4 A G 9: 105,644,511 E92G probably damaging Het
Prmt6 A T 3: 110,250,385 V196E possibly damaging Het
Ptprn2 T G 12: 116,722,119 M66R probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Recql5 A T 11: 115,923,276 S348T probably damaging Het
Rfk T G 19: 17,398,682 probably null Het
Selenbp1 A T 3: 94,944,102 M389L probably benign Het
Sipa1l2 G A 8: 125,492,290 R103C probably benign Het
Slc10a6 T A 5: 103,629,190 S15C probably damaging Het
Slc12a2 G T 18: 57,932,524 V944L probably benign Het
Slc16a11 T A 11: 70,215,317 L127Q possibly damaging Het
St6gal1 A G 16: 23,356,228 Y272C probably damaging Het
Stab2 C A 10: 86,981,135 V133F probably benign Het
Stradb G A 1: 58,992,726 V266I probably damaging Het
Tmem150b A G 7: 4,720,759 W140R probably benign Het
Tnnt3 A T 7: 142,512,096 K157* probably null Het
Trove2 T C 1: 143,770,873 T45A probably damaging Het
Ttn T G 2: 76,723,769 K30863N probably damaging Het
Vldlr G A 19: 27,243,136 R592H probably benign Het
Vmn1r12 A T 6: 57,158,898 probably benign Het
Vmn2r63 A C 7: 42,925,269 S519R probably damaging Het
Zbtb22 G C 17: 33,918,497 E539Q probably damaging Het
Zbtb44 G A 9: 31,054,079 A262T probably benign Het
Zfp280d A T 9: 72,324,072 N455I probably damaging Het
Zfp287 T C 11: 62,725,263 N201D probably damaging Het
Zfp988 T C 4: 147,332,294 L395P probably damaging Het
Other mutations in Pcdhb19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Pcdhb19 APN 18 37497989 missense probably damaging 1.00
IGL02070:Pcdhb19 APN 18 37498544 missense probably damaging 1.00
IGL02348:Pcdhb19 APN 18 37498808 missense probably damaging 1.00
IGL02866:Pcdhb19 APN 18 37499110 missense possibly damaging 0.91
IGL02869:Pcdhb19 APN 18 37498637 missense probably damaging 0.98
IGL03118:Pcdhb19 APN 18 37499565 intron probably benign
IGL03120:Pcdhb19 APN 18 37498156 missense probably benign 0.09
IGL03135:Pcdhb19 APN 18 37498535 missense probably benign 0.37
IGL03366:Pcdhb19 APN 18 37498612 missense possibly damaging 0.95
R0147:Pcdhb19 UTSW 18 37497182 missense probably benign 0.01
R0148:Pcdhb19 UTSW 18 37497182 missense probably benign 0.01
R0432:Pcdhb19 UTSW 18 37499535 missense probably benign 0.01
R0609:Pcdhb19 UTSW 18 37497952 missense probably benign
R1438:Pcdhb19 UTSW 18 37497962 missense probably damaging 1.00
R2255:Pcdhb19 UTSW 18 37497944 missense probably benign 0.00
R2265:Pcdhb19 UTSW 18 37497683 missense probably damaging 0.99
R3500:Pcdhb19 UTSW 18 37497479 nonsense probably null
R3708:Pcdhb19 UTSW 18 37497389 missense probably benign 0.04
R4165:Pcdhb19 UTSW 18 37499190 missense probably benign
R4166:Pcdhb19 UTSW 18 37499190 missense probably benign
R4863:Pcdhb19 UTSW 18 37499108 missense probably benign 0.00
R5217:Pcdhb19 UTSW 18 37497886 missense probably benign 0.00
R5770:Pcdhb19 UTSW 18 37498037 missense possibly damaging 0.73
R6031:Pcdhb19 UTSW 18 37497723 missense probably damaging 1.00
R6031:Pcdhb19 UTSW 18 37497723 missense probably damaging 1.00
R6372:Pcdhb19 UTSW 18 37497366 missense probably benign 0.04
R6454:Pcdhb19 UTSW 18 37499269 missense probably benign 0.43
R6985:Pcdhb19 UTSW 18 37497158 missense probably benign 0.00
R7662:Pcdhb19 UTSW 18 37498735 missense probably damaging 0.98
R7910:Pcdhb19 UTSW 18 37497667 missense probably benign 0.43
R8041:Pcdhb19 UTSW 18 37497314 missense possibly damaging 0.87
R8318:Pcdhb19 UTSW 18 37497946 missense possibly damaging 0.86
X0062:Pcdhb19 UTSW 18 37497175 missense probably benign
Z1177:Pcdhb19 UTSW 18 37498445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGACAATGCGCCCTTCG -3'
(R):5'- TAGAGTGTTAGGGCGTCCTC -3'

Sequencing Primer
(F):5'- GTGCTCTACCCGATGCAGAAC -3'
(R):5'- TAGGGCGTCCTCTTCGTGC -3'
Posted On2019-11-12