Incidental Mutation 'R7659:Olfr1112'
ID591412
Institutional Source Beutler Lab
Gene Symbol Olfr1112
Ensembl Gene ENSMUSG00000044487
Gene Nameolfactory receptor 1112
SynonymsGA_x6K02T2Q125-48676316-48677272, MOR264-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7659 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87187798-87192767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87192365 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 226 (V226E)
Ref Sequence ENSEMBL: ENSMUSP00000149960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053050] [ENSMUST00000216772]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053050
AA Change: V226E

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052341
Gene: ENSMUSG00000044487
AA Change: V226E

DomainStartEndE-ValueType
Pfam:7tm_4 38 315 2.4e-52 PFAM
Pfam:7tm_1 48 297 1.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216772
AA Change: V226E

PolyPhen 2 Score 0.774 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh2 T C 5: 121,568,960 E498G probably damaging Het
Ankar T C 1: 72,690,135 T284A possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp6v0a4 A G 6: 38,071,972 I452T probably damaging Het
Azgp1 G T 5: 137,987,513 A133S probably damaging Het
Bmp2k T C 5: 97,074,719 S667P unknown Het
C1qtnf9 T A 14: 60,772,304 I3N possibly damaging Het
C530025M09Rik T G 2: 149,830,619 T199P unknown Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Cass4 A G 2: 172,427,027 D343G probably damaging Het
Ccdc84 T C 9: 44,413,493 E164G probably damaging Het
Col6a3 T A 1: 90,781,745 T2517S unknown Het
Dbr1 A G 9: 99,576,610 T78A probably damaging Het
Dnah9 A G 11: 65,989,780 F2664L probably damaging Het
Eif2ak1 T C 5: 143,889,462 I431T probably damaging Het
Got1 A G 19: 43,504,639 V281A probably benign Het
Gpld1 A C 13: 24,979,981 R555S probably benign Het
Gpr149 T C 3: 62,603,835 R248G probably benign Het
Hps3 G A 3: 20,022,814 R395* probably null Het
Inpp5b T C 4: 124,795,426 L833P probably damaging Het
Itgb4 A T 11: 115,979,731 S129C probably damaging Het
Lgr4 T A 2: 109,996,766 V205E probably damaging Het
Mbd3 T C 10: 80,395,185 N96S probably damaging Het
Mki67 A G 7: 135,697,426 S1960P probably damaging Het
Mogs G A 6: 83,116,825 probably null Het
Muc6 T C 7: 141,637,060 T2567A possibly damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Nae1 A G 8: 104,516,164 V432A probably benign Het
Nav3 T G 10: 109,766,990 T1233P probably benign Het
Nme9 G A 9: 99,470,857 A287T possibly damaging Het
Nmrk1 A G 19: 18,636,135 I8V probably benign Het
Noa1 T C 5: 77,309,390 N223D not run Het
Nr4a3 T C 4: 48,051,269 Y8H probably damaging Het
Olfr1181 T C 2: 88,423,926 Y33C probably damaging Het
Olfr124 A T 17: 37,805,163 Q6L probably benign Het
Olfr25 T C 9: 38,329,716 V40A possibly damaging Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Olfr649 T C 7: 104,190,187 S7G probably benign Het
Olfr733 T C 14: 50,299,241 I23V probably benign Het
Olfr847 C T 9: 19,375,558 A108T probably benign Het
Otoa T A 7: 121,134,044 H711Q probably benign Het
Otogl T A 10: 107,777,120 E2048D probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pcdha3 A G 18: 36,948,166 T654A probably benign Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Ppt1 T A 4: 122,836,333 H26Q probably benign Het
Prim1 T C 10: 128,026,589 probably null Het
Prmt7 G T 8: 106,237,286 A271S probably benign Het
Ptprd T C 4: 76,128,916 D124G probably benign Het
Rad54l2 T C 9: 106,713,578 K450E probably benign Het
Rasgrp2 G T 19: 6,401,827 V13L probably damaging Het
Sapcd2 A G 2: 25,375,966 probably null Het
Siglecf A G 7: 43,351,770 Y54C probably damaging Het
Stk31 T A 6: 49,423,406 N388K probably benign Het
Timm23 A C 14: 32,198,978 Y52* probably null Het
Tm9sf1 A T 14: 55,636,335 F569I probably damaging Het
Tmprss9 C A 10: 80,893,009 A592E probably damaging Het
Trim30d A T 7: 104,472,347 V397E probably benign Het
Tshz1 A T 18: 84,016,075 N69K probably damaging Het
Upk2 A C 9: 44,453,511 S130R probably damaging Het
Vmn1r80 A G 7: 12,193,050 Y29C probably damaging Het
Vmn2r96 T C 17: 18,573,487 I31T probably benign Het
Zfp975 T C 7: 42,662,424 Q255R probably benign Het
Other mutations in Olfr1112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Olfr1112 APN 2 87191848 missense probably benign 0.00
R0665:Olfr1112 UTSW 2 87192308 missense probably damaging 1.00
R1698:Olfr1112 UTSW 2 87191737 missense probably benign 0.00
R1717:Olfr1112 UTSW 2 87191903 missense probably benign 0.38
R1768:Olfr1112 UTSW 2 87191698 missense probably benign
R1872:Olfr1112 UTSW 2 87191878 missense possibly damaging 0.96
R3441:Olfr1112 UTSW 2 87191818 missense probably benign 0.00
R4017:Olfr1112 UTSW 2 87192502 missense probably benign 0.03
R4895:Olfr1112 UTSW 2 87191848 missense probably benign 0.00
R5451:Olfr1112 UTSW 2 87192452 missense probably damaging 1.00
R6171:Olfr1112 UTSW 2 87192365 missense possibly damaging 0.77
R6851:Olfr1112 UTSW 2 87192469 missense probably benign 0.37
R7263:Olfr1112 UTSW 2 87192132 nonsense probably null
R7622:Olfr1112 UTSW 2 87192250 missense probably benign 0.01
R7798:Olfr1112 UTSW 2 87192292 missense probably benign 0.00
R7880:Olfr1112 UTSW 2 87192090 nonsense probably null
R7963:Olfr1112 UTSW 2 87192090 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGCTGGCTGTTGGATAAG -3'
(R):5'- ATCATGGGGTTGAACAGTGG -3'

Sequencing Primer
(F):5'- AGGGTTCACATACTGGATCTTC -3'
(R):5'- GTTGAACAGTGGAGTCACAAC -3'
Posted On2019-11-12