Incidental Mutation 'R7659:Cass4'
ID591416
Institutional Source Beutler Lab
Gene Symbol Cass4
Ensembl Gene ENSMUSG00000074570
Gene NameCas scaffolding protein family member 4
SynonymsF730031O20Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001033538.2, NM_001080820.1; MGI:2444482

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7659 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location172393794-172433757 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172427027 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 343 (D343G)
Ref Sequence ENSEMBL: ENSMUSP00000104764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099061] [ENSMUST00000103073] [ENSMUST00000109136] [ENSMUST00000228775]
Predicted Effect probably damaging
Transcript: ENSMUST00000099061
AA Change: D343G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096660
Gene: ENSMUSG00000074570
AA Change: D343G

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 4.2e-68 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103073
AA Change: D343G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099362
Gene: ENSMUSG00000074570
AA Change: D343G

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 591 7.5e-69 PFAM
Pfam:DUF3513 587 778 8.8e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109136
AA Change: D343G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104764
Gene: ENSMUSG00000074570
AA Change: D343G

DomainStartEndE-ValueType
SH3 14 72 5.65e-16 SMART
low complexity region 392 428 N/A INTRINSIC
Pfam:Serine_rich 433 589 3.8e-58 PFAM
Pfam:DUF3513 593 803 1.6e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000228775
AA Change: D345G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (66/66)
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh2 T C 5: 121,568,960 E498G probably damaging Het
Ankar T C 1: 72,690,135 T284A possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp6v0a4 A G 6: 38,071,972 I452T probably damaging Het
Azgp1 G T 5: 137,987,513 A133S probably damaging Het
Bmp2k T C 5: 97,074,719 S667P unknown Het
C1qtnf9 T A 14: 60,772,304 I3N possibly damaging Het
C530025M09Rik T G 2: 149,830,619 T199P unknown Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Ccdc84 T C 9: 44,413,493 E164G probably damaging Het
Col6a3 T A 1: 90,781,745 T2517S unknown Het
Dbr1 A G 9: 99,576,610 T78A probably damaging Het
Dnah9 A G 11: 65,989,780 F2664L probably damaging Het
Eif2ak1 T C 5: 143,889,462 I431T probably damaging Het
Got1 A G 19: 43,504,639 V281A probably benign Het
Gpld1 A C 13: 24,979,981 R555S probably benign Het
Gpr149 T C 3: 62,603,835 R248G probably benign Het
Hps3 G A 3: 20,022,814 R395* probably null Het
Inpp5b T C 4: 124,795,426 L833P probably damaging Het
Itgb4 A T 11: 115,979,731 S129C probably damaging Het
Kif1a T A 1: 93,046,820 probably benign Het
Lgr4 T A 2: 109,996,766 V205E probably damaging Het
Mbd3 T C 10: 80,395,185 N96S probably damaging Het
Mcam T A 9: 44,136,770 C136S unknown Het
Mki67 A G 7: 135,697,426 S1960P probably damaging Het
Mogs G A 6: 83,116,825 probably null Het
Muc6 T C 7: 141,637,060 T2567A possibly damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Nae1 A G 8: 104,516,164 V432A probably benign Het
Nav3 T G 10: 109,766,990 T1233P probably benign Het
Nme9 G A 9: 99,470,857 A287T possibly damaging Het
Nmrk1 A G 19: 18,636,135 I8V probably benign Het
Noa1 T C 5: 77,309,390 N223D not run Het
Nr4a3 T C 4: 48,051,269 Y8H probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr1181 T C 2: 88,423,926 Y33C probably damaging Het
Olfr124 A T 17: 37,805,163 Q6L probably benign Het
Olfr25 T C 9: 38,329,716 V40A possibly damaging Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Olfr649 T C 7: 104,190,187 S7G probably benign Het
Olfr733 T C 14: 50,299,241 I23V probably benign Het
Olfr847 C T 9: 19,375,558 A108T probably benign Het
Otoa T A 7: 121,134,044 H711Q probably benign Het
Otogl T A 10: 107,777,120 E2048D probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pcdha3 A G 18: 36,948,166 T654A probably benign Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Ppt1 T A 4: 122,836,333 H26Q probably benign Het
Prim1 T C 10: 128,026,589 probably null Het
Prmt7 G T 8: 106,237,286 A271S probably benign Het
Ptprd T C 4: 76,128,916 D124G probably benign Het
Rad54l2 T C 9: 106,713,578 K450E probably benign Het
Rasgrp2 G T 19: 6,401,827 V13L probably damaging Het
Sapcd2 A G 2: 25,375,966 probably null Het
Siglecf A G 7: 43,351,770 Y54C probably damaging Het
Stk31 T A 6: 49,423,406 N388K probably benign Het
Timm23 A C 14: 32,198,978 Y52* probably null Het
Tm9sf1 A T 14: 55,636,335 F569I probably damaging Het
Tmprss9 C A 10: 80,893,009 A592E probably damaging Het
Trim30d A T 7: 104,472,347 V397E probably benign Het
Tshz1 A T 18: 84,016,075 N69K probably damaging Het
Upk2 A C 9: 44,453,511 S130R probably damaging Het
Vmn1r80 A G 7: 12,193,050 Y29C probably damaging Het
Vmn2r96 T C 17: 18,573,487 I31T probably benign Het
Zfp975 T C 7: 42,662,424 Q255R probably benign Het
Other mutations in Cass4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cass4 APN 2 172416250 missense probably damaging 1.00
IGL00846:Cass4 APN 2 172429723 intron probably benign
IGL01400:Cass4 APN 2 172427300 missense probably damaging 1.00
IGL01985:Cass4 APN 2 172427206 missense probably damaging 1.00
IGL02268:Cass4 APN 2 172427042 missense possibly damaging 0.76
IGL02592:Cass4 APN 2 172416328 missense probably benign 0.00
R0030:Cass4 UTSW 2 172427842 nonsense probably null
R0035:Cass4 UTSW 2 172416492 missense probably damaging 1.00
R0039:Cass4 UTSW 2 172426980 missense probably damaging 1.00
R0631:Cass4 UTSW 2 172432411 missense probably damaging 1.00
R1321:Cass4 UTSW 2 172424652 missense probably benign 0.05
R1352:Cass4 UTSW 2 172416495 missense probably damaging 0.98
R1612:Cass4 UTSW 2 172427078 missense possibly damaging 0.46
R1720:Cass4 UTSW 2 172427734 missense probably damaging 0.99
R1776:Cass4 UTSW 2 172427695 missense probably benign
R1918:Cass4 UTSW 2 172427339 missense possibly damaging 0.69
R2257:Cass4 UTSW 2 172427470 missense probably damaging 1.00
R2257:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R2262:Cass4 UTSW 2 172427254 missense probably damaging 1.00
R2924:Cass4 UTSW 2 172426672 missense possibly damaging 0.89
R3498:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3499:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3792:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3793:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R3901:Cass4 UTSW 2 172432558 missense probably damaging 1.00
R4899:Cass4 UTSW 2 172427869 missense probably benign
R5161:Cass4 UTSW 2 172432324 missense probably damaging 1.00
R5534:Cass4 UTSW 2 172426768 missense probably benign 0.13
R5646:Cass4 UTSW 2 172416245 missense probably damaging 1.00
R5799:Cass4 UTSW 2 172416187 missense probably damaging 1.00
R5873:Cass4 UTSW 2 172426768 missense probably benign 0.13
R6084:Cass4 UTSW 2 172426912 missense probably benign 0.01
R6360:Cass4 UTSW 2 172432611 missense probably damaging 1.00
R6432:Cass4 UTSW 2 172427719 missense probably damaging 1.00
R7116:Cass4 UTSW 2 172427969 missense unknown
R7212:Cass4 UTSW 2 172427186 nonsense probably null
R7549:Cass4 UTSW 2 172426798 missense probably benign 0.01
R7549:Cass4 UTSW 2 172426799 missense probably benign 0.00
R7594:Cass4 UTSW 2 172429648 missense probably benign 0.03
R8003:Cass4 UTSW 2 172427959 missense unknown
R8270:Cass4 UTSW 2 172427669 missense probably damaging 1.00
R8296:Cass4 UTSW 2 172427174 missense probably benign 0.28
R8378:Cass4 UTSW 2 172427794 missense probably benign 0.05
Z1177:Cass4 UTSW 2 172427575 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTCAGGTTCCAGAGCCATTC -3'
(R):5'- GCAACAGATAATCGGTCCGAG -3'

Sequencing Primer
(F):5'- TCCACACTGGAGCTGTGG -3'
(R):5'- CAGATAATCGGTCCGAGTCAGG -3'
Posted On2019-11-12