Mutagenetix > Incidental Mutations

Incidental Mutation 'R7659:Nr4a3'

591419

Institutional Source

Beutler Lab

Gene Symbol

Nr4a3

Ensembl Gene

ENSMUSG00000028341

Gene Name

nuclear receptor subfamily 4, group A, member 3

Synonyms

Nor1, TEC, MINOR, NOR-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7659 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48045153-48086447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 48051269 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 8 (Y8H)

Ref Sequence

ENSEMBL: ENSMUSP00000030025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030025]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030025
AA Change: Y8H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: Y8H

Domain	Start	End	E-Value	Type
Blast:HOLI	1	43	4e-18	BLAST
low complexity region	99	115	N/A	INTRINSIC
low complexity region	139	151	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
low complexity region	218	239	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
ZnF_C4	290	361	4.57e-39	SMART
low complexity region	376	396	N/A	INTRINSIC
HOLI	440	595	2.46e-21	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: Y37H

Domain	Start	End	E-Value	Type
Blast:HOLI	30	73	8e-19	BLAST
low complexity region	129	145	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC
low complexity region	226	240	N/A	INTRINSIC
low complexity region	248	269	N/A	INTRINSIC
low complexity region	299	318	N/A	INTRINSIC
ZnF_C4	320	391	4.57e-39	SMART
low complexity region	406	426	N/A	INTRINSIC
HOLI	470	625	2.46e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh2	T	C	5: 121,568,960	E498G	probably damaging	Het
Ankar	T	C	1: 72,690,135	T284A	possibly damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atp6v0a4	A	G	6: 38,071,972	I452T	probably damaging	Het
Azgp1	G	T	5: 137,987,513	A133S	probably damaging	Het
Bmp2k	T	C	5: 97,074,719	S667P	unknown	Het
C1qtnf9	T	A	14: 60,772,304	I3N	possibly damaging	Het
C530025M09Rik	T	G	2: 149,830,619	T199P	unknown	Het
Casc3	C	G	11: 98,809,873	R4G	unknown	Het
Cass4	A	G	2: 172,427,027	D343G	probably damaging	Het
Ccdc84	T	C	9: 44,413,493	E164G	probably damaging	Het
Col6a3	T	A	1: 90,781,745	T2517S	unknown	Het
Dbr1	A	G	9: 99,576,610	T78A	probably damaging	Het
Dnah9	A	G	11: 65,989,780	F2664L	probably damaging	Het
Eif2ak1	T	C	5: 143,889,462	I431T	probably damaging	Het
Got1	A	G	19: 43,504,639	V281A	probably benign	Het
Gpld1	A	C	13: 24,979,981	R555S	probably benign	Het
Gpr149	T	C	3: 62,603,835	R248G	probably benign	Het
Hps3	G	A	3: 20,022,814	R395*	probably null	Het
Inpp5b	T	C	4: 124,795,426	L833P	probably damaging	Het
Itgb4	A	T	11: 115,979,731	S129C	probably damaging	Het
Kif1a	T	A	1: 93,046,820		probably benign	Het
Lgr4	T	A	2: 109,996,766	V205E	probably damaging	Het
Mbd3	T	C	10: 80,395,185	N96S	probably damaging	Het
Mcam	T	A	9: 44,136,770	C136S	unknown	Het
Mki67	A	G	7: 135,697,426	S1960P	probably damaging	Het
Mogs	G	A	6: 83,116,825		probably null	Het
Muc6	T	C	7: 141,637,060	T2567A	possibly damaging	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Nae1	A	G	8: 104,516,164	V432A	probably benign	Het
Nav3	T	G	10: 109,766,990	T1233P	probably benign	Het
Nme9	G	A	9: 99,470,857	A287T	possibly damaging	Het
Nmrk1	A	G	19: 18,636,135	I8V	probably benign	Het
Noa1	T	C	5: 77,309,390	N223D	not run	Het
Olfr1112	T	A	2: 87,192,365	V226E	possibly damaging	Het
Olfr1181	T	C	2: 88,423,926	Y33C	probably damaging	Het
Olfr124	A	T	17: 37,805,163	Q6L	probably benign	Het
Olfr25	T	C	9: 38,329,716	V40A	possibly damaging	Het
Olfr344	T	A	2: 36,568,625	V9E	possibly damaging	Het
Olfr649	T	C	7: 104,190,187	S7G	probably benign	Het
Olfr733	T	C	14: 50,299,241	I23V	probably benign	Het
Olfr847	C	T	9: 19,375,558	A108T	probably benign	Het
Otoa	T	A	7: 121,134,044	H711Q	probably benign	Het
Otogl	T	A	10: 107,777,120	E2048D	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pcdha3	A	G	18: 36,948,166	T654A	probably benign	Het
Pigg	G	A	5: 108,338,619	V713I	probably benign	Het
Ppt1	T	A	4: 122,836,333	H26Q	probably benign	Het
Prim1	T	C	10: 128,026,589		probably null	Het
Prmt7	G	T	8: 106,237,286	A271S	probably benign	Het
Ptprd	T	C	4: 76,128,916	D124G	probably benign	Het
Rad54l2	T	C	9: 106,713,578	K450E	probably benign	Het
Rasgrp2	G	T	19: 6,401,827	V13L	probably damaging	Het
Sapcd2	A	G	2: 25,375,966		probably null	Het
Siglecf	A	G	7: 43,351,770	Y54C	probably damaging	Het
Stk31	T	A	6: 49,423,406	N388K	probably benign	Het
Timm23	A	C	14: 32,198,978	Y52*	probably null	Het
Tm9sf1	A	T	14: 55,636,335	F569I	probably damaging	Het
Tmprss9	C	A	10: 80,893,009	A592E	probably damaging	Het
Trim30d	A	T	7: 104,472,347	V397E	probably benign	Het
Tshz1	A	T	18: 84,016,075	N69K	probably damaging	Het
Upk2	A	C	9: 44,453,511	S130R	probably damaging	Het
Vmn1r80	A	G	7: 12,193,050	Y29C	probably damaging	Het
Vmn2r96	T	C	17: 18,573,487	I31T	probably benign	Het
Zfp975	T	C	7: 42,662,424	Q255R	probably benign	Het

Other mutations in Nr4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Nr4a3	APN	4	48051586	missense	possibly damaging	0.48
IGL01407:Nr4a3	APN	4	48083201	missense	probably benign	0.00
IGL01454:Nr4a3	APN	4	48067803	missense	probably damaging	1.00
IGL01472:Nr4a3	APN	4	48071133	missense	probably damaging	1.00
IGL02622:Nr4a3	APN	4	48051649	missense	probably benign	0.06
IGL03401:Nr4a3	APN	4	48070987	splice site	probably null
bulbous	UTSW	4	48083255	missense	probably damaging	0.98
cronus	UTSW	4	48056539	missense	probably damaging	1.00
I1329:Nr4a3	UTSW	4	48051585	missense	probably benign	0.12
R0486:Nr4a3	UTSW	4	48056525	splice site	probably benign
R0610:Nr4a3	UTSW	4	48051903	missense	probably benign	0.10
R1170:Nr4a3	UTSW	4	48051564	missense	probably damaging	0.98
R1170:Nr4a3	UTSW	4	48083324	missense	probably benign	0.01
R1440:Nr4a3	UTSW	4	48051777	missense	probably benign
R1977:Nr4a3	UTSW	4	48056539	missense	probably damaging	1.00
R2016:Nr4a3	UTSW	4	48083252	missense	probably damaging	1.00
R2046:Nr4a3	UTSW	4	48067807	missense	possibly damaging	0.82
R2055:Nr4a3	UTSW	4	48067771	missense	possibly damaging	0.86
R3707:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R3708:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R4246:Nr4a3	UTSW	4	48083125	missense	possibly damaging	0.86
R4657:Nr4a3	UTSW	4	48051522	missense	probably damaging	1.00
R4870:Nr4a3	UTSW	4	48051651	missense	possibly damaging	0.73
R5434:Nr4a3	UTSW	4	48067861	missense	probably damaging	1.00
R5539:Nr4a3	UTSW	4	48056525	splice site	probably null
R5663:Nr4a3	UTSW	4	48055931	missense	probably damaging	1.00
R6513:Nr4a3	UTSW	4	48083255	missense	probably damaging	0.98
R6664:Nr4a3	UTSW	4	48056006	missense	probably damaging	1.00
R6921:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R6940:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R7076:Nr4a3	UTSW	4	48055957	missense	probably damaging	1.00
R7322:Nr4a3	UTSW	4	48083238	missense	probably benign	0.00
R7347:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7348:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7349:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7361:Nr4a3	UTSW	4	48083203	missense	probably benign	0.00
R7365:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7366:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7418:Nr4a3	UTSW	4	48051476	missense	probably damaging	1.00
R7895:Nr4a3	UTSW	4	48051390	missense	probably benign
R7986:Nr4a3	UTSW	4	48055954	missense	probably damaging	1.00
R8022:Nr4a3	UTSW	4	48051510	missense	probably damaging	1.00
R8226:Nr4a3	UTSW	4	48056588	missense	probably damaging	1.00
R8328:Nr4a3	UTSW	4	48051323	missense	probably damaging	1.00
R8349:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40
R8403:Nr4a3	UTSW	4	48051348	missense	probably damaging	1.00
R8449:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- AGGAACTCAGCTGTCTTCCCAG -3'
(R):5'- GCATTTGGTACAGGCAGGAG -3'

Sequencing Primer
(F):5'- TTCCCAGCCAGGAAGAAAGTAAGC -3'
(R):5'- GCTTGAGTTCGCAGCTGC -3'

Posted On

2019-11-12