Incidental Mutation 'R7659:Armh1'
ID591421
Institutional Source Beutler Lab
Gene Symbol Armh1
Ensembl Gene ENSMUSG00000060268
Gene Namearmadillo-like helical domain containing 1
SynonymsLOC381543, LOC381544, Ncrna00082
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R7659 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117213333-117252125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 117213741 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 396 (A396S)
Ref Sequence ENSEMBL: ENSMUSP00000128613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077500] [ENSMUST00000165128]
Predicted Effect probably benign
Transcript: ENSMUST00000077500
SMART Domains Protein: ENSMUSP00000076706
Gene: ENSMUSG00000060268

DomainStartEndE-ValueType
SCOP:d1qbkb_ 156 272 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165128
AA Change: A396S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128613
Gene: ENSMUSG00000060268
AA Change: A396S

DomainStartEndE-ValueType
low complexity region 162 176 N/A INTRINSIC
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh2 T C 5: 121,568,960 E498G probably damaging Het
Ankar T C 1: 72,690,135 T284A possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Atp6v0a4 A G 6: 38,071,972 I452T probably damaging Het
Azgp1 G T 5: 137,987,513 A133S probably damaging Het
Bmp2k T C 5: 97,074,719 S667P unknown Het
C1qtnf9 T A 14: 60,772,304 I3N possibly damaging Het
C530025M09Rik T G 2: 149,830,619 T199P unknown Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Cass4 A G 2: 172,427,027 D343G probably damaging Het
Ccdc84 T C 9: 44,413,493 E164G probably damaging Het
Col6a3 T A 1: 90,781,745 T2517S unknown Het
Dbr1 A G 9: 99,576,610 T78A probably damaging Het
Dnah9 A G 11: 65,989,780 F2664L probably damaging Het
Eif2ak1 T C 5: 143,889,462 I431T probably damaging Het
Got1 A G 19: 43,504,639 V281A probably benign Het
Gpld1 A C 13: 24,979,981 R555S probably benign Het
Gpr149 T C 3: 62,603,835 R248G probably benign Het
Hps3 G A 3: 20,022,814 R395* probably null Het
Inpp5b T C 4: 124,795,426 L833P probably damaging Het
Itgb4 A T 11: 115,979,731 S129C probably damaging Het
Kif1a T A 1: 93,046,820 probably benign Het
Lgr4 T A 2: 109,996,766 V205E probably damaging Het
Mbd3 T C 10: 80,395,185 N96S probably damaging Het
Mcam T A 9: 44,136,770 C136S unknown Het
Mki67 A G 7: 135,697,426 S1960P probably damaging Het
Mogs G A 6: 83,116,825 probably null Het
Muc6 T C 7: 141,637,060 T2567A possibly damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Nae1 A G 8: 104,516,164 V432A probably benign Het
Nav3 T G 10: 109,766,990 T1233P probably benign Het
Nme9 G A 9: 99,470,857 A287T possibly damaging Het
Nmrk1 A G 19: 18,636,135 I8V probably benign Het
Noa1 T C 5: 77,309,390 N223D not run Het
Nr4a3 T C 4: 48,051,269 Y8H probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr1181 T C 2: 88,423,926 Y33C probably damaging Het
Olfr124 A T 17: 37,805,163 Q6L probably benign Het
Olfr25 T C 9: 38,329,716 V40A possibly damaging Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Olfr649 T C 7: 104,190,187 S7G probably benign Het
Olfr733 T C 14: 50,299,241 I23V probably benign Het
Olfr847 C T 9: 19,375,558 A108T probably benign Het
Otoa T A 7: 121,134,044 H711Q probably benign Het
Otogl T A 10: 107,777,120 E2048D probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pcdha3 A G 18: 36,948,166 T654A probably benign Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Ppt1 T A 4: 122,836,333 H26Q probably benign Het
Prim1 T C 10: 128,026,589 probably null Het
Prmt7 G T 8: 106,237,286 A271S probably benign Het
Ptprd T C 4: 76,128,916 D124G probably benign Het
Rad54l2 T C 9: 106,713,578 K450E probably benign Het
Rasgrp2 G T 19: 6,401,827 V13L probably damaging Het
Sapcd2 A G 2: 25,375,966 probably null Het
Siglecf A G 7: 43,351,770 Y54C probably damaging Het
Stk31 T A 6: 49,423,406 N388K probably benign Het
Timm23 A C 14: 32,198,978 Y52* probably null Het
Tm9sf1 A T 14: 55,636,335 F569I probably damaging Het
Tmprss9 C A 10: 80,893,009 A592E probably damaging Het
Trim30d A T 7: 104,472,347 V397E probably benign Het
Tshz1 A T 18: 84,016,075 N69K probably damaging Het
Upk2 A C 9: 44,453,511 S130R probably damaging Het
Vmn1r80 A G 7: 12,193,050 Y29C probably damaging Het
Vmn2r96 T C 17: 18,573,487 I31T probably benign Het
Zfp975 T C 7: 42,662,424 Q255R probably benign Het
Other mutations in Armh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Armh1 APN 4 117237663 missense probably benign 0.37
R0350:Armh1 UTSW 4 117215556 nonsense probably null
R0584:Armh1 UTSW 4 117229850 missense probably damaging 1.00
R1570:Armh1 UTSW 4 117229992 missense probably damaging 1.00
R4335:Armh1 UTSW 4 117214463 missense probably damaging 0.99
R4898:Armh1 UTSW 4 117237780 missense probably damaging 1.00
R5939:Armh1 UTSW 4 117229922 missense probably damaging 1.00
R6300:Armh1 UTSW 4 117231782 missense probably damaging 1.00
R6815:Armh1 UTSW 4 117229937 missense probably damaging 1.00
R7526:Armh1 UTSW 4 117213741 missense probably benign 0.02
R7529:Armh1 UTSW 4 117213741 missense probably benign 0.02
R7630:Armh1 UTSW 4 117213741 missense probably benign 0.02
R7632:Armh1 UTSW 4 117213741 missense probably benign 0.02
R7660:Armh1 UTSW 4 117213741 missense probably benign 0.02
R7662:Armh1 UTSW 4 117213741 missense probably benign 0.02
R7663:Armh1 UTSW 4 117213741 missense probably benign 0.02
R7665:Armh1 UTSW 4 117213741 missense probably benign 0.02
R7666:Armh1 UTSW 4 117213741 missense probably benign 0.02
R7713:Armh1 UTSW 4 117214228 missense possibly damaging 0.65
R8030:Armh1 UTSW 4 117229987 missense probably benign 0.31
R8433:Armh1 UTSW 4 117228338 missense probably benign 0.43
Z1088:Armh1 UTSW 4 117213795 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCATATCATTGGAGCCCGTG -3'
(R):5'- AGGTAACCCTTCCTCCCTAG -3'

Sequencing Primer
(F):5'- TATCATTGGAGCCCGTGGAGAAG -3'
(R):5'- AGGGGTGCACTGCTCTG -3'
Posted On2019-11-12