Incidental Mutation 'R7659:Atp6v0a4'
ID 591430
Institutional Source Beutler Lab
Gene Symbol Atp6v0a4
Ensembl Gene ENSMUSG00000038600
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A4
Synonyms V-ATPase alpha 4, Atp6n1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7659 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 38048483-38124586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38071972 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 452 (I452T)
Ref Sequence ENSEMBL: ENSMUSP00000039381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040259] [ENSMUST00000114908]
AlphaFold Q920R6
Predicted Effect probably damaging
Transcript: ENSMUST00000040259
AA Change: I452T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039381
Gene: ENSMUSG00000038600
AA Change: I452T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 824 3.5e-293 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114908
AA Change: I452T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110558
Gene: ENSMUSG00000038600
AA Change: I452T

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 823 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display postnatal or premature lethality, hyperchloremic hypokalemic acidosis with hypocitraturia, inner ear defects, impaired hearing, and impaired olfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh2 T C 5: 121,568,960 E498G probably damaging Het
Ankar T C 1: 72,690,135 T284A possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Azgp1 G T 5: 137,987,513 A133S probably damaging Het
Bmp2k T C 5: 97,074,719 S667P unknown Het
C1qtnf9 T A 14: 60,772,304 I3N possibly damaging Het
C530025M09Rik T G 2: 149,830,619 T199P unknown Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Cass4 A G 2: 172,427,027 D343G probably damaging Het
Ccdc84 T C 9: 44,413,493 E164G probably damaging Het
Col6a3 T A 1: 90,781,745 T2517S unknown Het
Dbr1 A G 9: 99,576,610 T78A probably damaging Het
Dnah9 A G 11: 65,989,780 F2664L probably damaging Het
Eif2ak1 T C 5: 143,889,462 I431T probably damaging Het
Got1 A G 19: 43,504,639 V281A probably benign Het
Gpld1 A C 13: 24,979,981 R555S probably benign Het
Gpr149 T C 3: 62,603,835 R248G probably benign Het
Hps3 G A 3: 20,022,814 R395* probably null Het
Inpp5b T C 4: 124,795,426 L833P probably damaging Het
Itgb4 A T 11: 115,979,731 S129C probably damaging Het
Kif1a T A 1: 93,046,820 probably benign Het
Lgr4 T A 2: 109,996,766 V205E probably damaging Het
Mbd3 T C 10: 80,395,185 N96S probably damaging Het
Mcam T A 9: 44,136,770 C136S unknown Het
Mki67 A G 7: 135,697,426 S1960P probably damaging Het
Mogs G A 6: 83,116,825 probably null Het
Muc6 T C 7: 141,637,060 T2567A possibly damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Nae1 A G 8: 104,516,164 V432A probably benign Het
Nav3 T G 10: 109,766,990 T1233P probably benign Het
Nme9 G A 9: 99,470,857 A287T possibly damaging Het
Nmrk1 A G 19: 18,636,135 I8V probably benign Het
Noa1 T C 5: 77,309,390 N223D not run Het
Nr4a3 T C 4: 48,051,269 Y8H probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr1181 T C 2: 88,423,926 Y33C probably damaging Het
Olfr124 A T 17: 37,805,163 Q6L probably benign Het
Olfr25 T C 9: 38,329,716 V40A possibly damaging Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Olfr649 T C 7: 104,190,187 S7G probably benign Het
Olfr733 T C 14: 50,299,241 I23V probably benign Het
Olfr847 C T 9: 19,375,558 A108T probably benign Het
Otoa T A 7: 121,134,044 H711Q probably benign Het
Otogl T A 10: 107,777,120 E2048D probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pcdha3 A G 18: 36,948,166 T654A probably benign Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Ppt1 T A 4: 122,836,333 H26Q probably benign Het
Prim1 T C 10: 128,026,589 probably null Het
Prmt7 G T 8: 106,237,286 A271S probably benign Het
Ptprd T C 4: 76,128,916 D124G probably benign Het
Rad54l2 T C 9: 106,713,578 K450E probably benign Het
Rasgrp2 G T 19: 6,401,827 V13L probably damaging Het
Sapcd2 A G 2: 25,375,966 probably null Het
Siglecf A G 7: 43,351,770 Y54C probably damaging Het
Stk31 T A 6: 49,423,406 N388K probably benign Het
Timm23 A C 14: 32,198,978 Y52* probably null Het
Tm9sf1 A T 14: 55,636,335 F569I probably damaging Het
Tmprss9 C A 10: 80,893,009 A592E probably damaging Het
Trim30d A T 7: 104,472,347 V397E probably benign Het
Tshz1 A T 18: 84,016,075 N69K probably damaging Het
Upk2 A C 9: 44,453,511 S130R probably damaging Het
Vmn1r80 A G 7: 12,193,050 Y29C probably damaging Het
Vmn2r96 T C 17: 18,573,487 I31T probably benign Het
Zfp975 T C 7: 42,662,424 Q255R probably benign Het
Other mutations in Atp6v0a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Atp6v0a4 APN 6 38092790 nonsense probably null
IGL01358:Atp6v0a4 APN 6 38074210 missense probably damaging 1.00
IGL01781:Atp6v0a4 APN 6 38074160 missense possibly damaging 0.91
IGL01934:Atp6v0a4 APN 6 38051546 missense possibly damaging 0.90
IGL01953:Atp6v0a4 APN 6 38054617 missense probably damaging 0.97
IGL03190:Atp6v0a4 APN 6 38054556 missense probably benign 0.02
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0049:Atp6v0a4 UTSW 6 38082081 missense probably damaging 1.00
R0100:Atp6v0a4 UTSW 6 38076815 missense probably benign
R0105:Atp6v0a4 UTSW 6 38053129 splice site probably benign
R1569:Atp6v0a4 UTSW 6 38050625 missense probably damaging 1.00
R1754:Atp6v0a4 UTSW 6 38067829 missense probably benign
R2142:Atp6v0a4 UTSW 6 38082936 nonsense probably null
R2162:Atp6v0a4 UTSW 6 38088646 missense possibly damaging 0.89
R2433:Atp6v0a4 UTSW 6 38082029 critical splice donor site probably null
R2892:Atp6v0a4 UTSW 6 38053017 missense probably benign 0.00
R4599:Atp6v0a4 UTSW 6 38078802 missense probably benign 0.01
R4687:Atp6v0a4 UTSW 6 38092465 missense possibly damaging 0.95
R4716:Atp6v0a4 UTSW 6 38061064 missense probably damaging 1.00
R4938:Atp6v0a4 UTSW 6 38078814 missense possibly damaging 0.80
R5062:Atp6v0a4 UTSW 6 38074183 missense probably benign 0.05
R5437:Atp6v0a4 UTSW 6 38076733 missense probably damaging 0.97
R5440:Atp6v0a4 UTSW 6 38092817 missense probably damaging 0.96
R5697:Atp6v0a4 UTSW 6 38050507 splice site probably null
R5698:Atp6v0a4 UTSW 6 38050507 splice site probably null
R6425:Atp6v0a4 UTSW 6 38050511 missense possibly damaging 0.88
R8004:Atp6v0a4 UTSW 6 38050549 missense possibly damaging 0.93
R8270:Atp6v0a4 UTSW 6 38074229 missense probably damaging 1.00
R8683:Atp6v0a4 UTSW 6 38048991 makesense probably null
R9007:Atp6v0a4 UTSW 6 38053053 missense probably benign
R9359:Atp6v0a4 UTSW 6 38082113 missense probably benign 0.21
R9475:Atp6v0a4 UTSW 6 38060982 missense probably damaging 1.00
Z1176:Atp6v0a4 UTSW 6 38049036 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGCCCTGCAGTCTTTGGATG -3'
(R):5'- TGCACAGTGAATAAATGCCCAGG -3'

Sequencing Primer
(F):5'- CTTTGGATGGCCTGCAAGC -3'
(R):5'- AGCTGACCTACATAAGCTCGTGTG -3'
Posted On 2019-11-12