Incidental Mutation 'R7659:Stk31'
ID591431
Institutional Source Beutler Lab
Gene Symbol Stk31
Ensembl Gene ENSMUSG00000023403
Gene Nameserine threonine kinase 31
SynonymsC330007K24Rik
Accession Numbers

Genbank: NM_029916; MGI: 1924735

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7659 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location49395604-49469501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49423406 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 388 (N388K)
Ref Sequence ENSEMBL: ENSMUSP00000024171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024171] [ENSMUST00000163954] [ENSMUST00000172459]
Predicted Effect probably benign
Transcript: ENSMUST00000024171
AA Change: N388K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000024171
Gene: ENSMUSG00000023403
AA Change: N388K

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 768 932 4.6e-9 PFAM
Pfam:Pkinase 794 973 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163954
AA Change: N388K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000127545
Gene: ENSMUSG00000023403
AA Change: N388K

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 784 922 7.4e-9 PFAM
Pfam:Pkinase 794 940 1.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172459
AA Change: N388K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000132896
Gene: ENSMUSG00000023403
AA Change: N388K

DomainStartEndE-ValueType
TUDOR 81 135 1.34e-8 SMART
coiled coil region 298 345 N/A INTRINSIC
Pfam:Pkinase_Tyr 739 890 5.2e-9 PFAM
Pfam:Pkinase 749 917 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative protein kinase with a tudor domain, and shows testis-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display normal embryonic development and spermatogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh2 T C 5: 121,568,960 E498G probably damaging Het
Ankar T C 1: 72,690,135 T284A possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp6v0a4 A G 6: 38,071,972 I452T probably damaging Het
Azgp1 G T 5: 137,987,513 A133S probably damaging Het
Bmp2k T C 5: 97,074,719 S667P unknown Het
C1qtnf9 T A 14: 60,772,304 I3N possibly damaging Het
C530025M09Rik T G 2: 149,830,619 T199P unknown Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Cass4 A G 2: 172,427,027 D343G probably damaging Het
Ccdc84 T C 9: 44,413,493 E164G probably damaging Het
Col6a3 T A 1: 90,781,745 T2517S unknown Het
Dbr1 A G 9: 99,576,610 T78A probably damaging Het
Dnah9 A G 11: 65,989,780 F2664L probably damaging Het
Eif2ak1 T C 5: 143,889,462 I431T probably damaging Het
Got1 A G 19: 43,504,639 V281A probably benign Het
Gpld1 A C 13: 24,979,981 R555S probably benign Het
Gpr149 T C 3: 62,603,835 R248G probably benign Het
Hps3 G A 3: 20,022,814 R395* probably null Het
Inpp5b T C 4: 124,795,426 L833P probably damaging Het
Itgb4 A T 11: 115,979,731 S129C probably damaging Het
Lgr4 T A 2: 109,996,766 V205E probably damaging Het
Mbd3 T C 10: 80,395,185 N96S probably damaging Het
Mki67 A G 7: 135,697,426 S1960P probably damaging Het
Mogs G A 6: 83,116,825 probably null Het
Muc6 T C 7: 141,637,060 T2567A possibly damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Nae1 A G 8: 104,516,164 V432A probably benign Het
Nav3 T G 10: 109,766,990 T1233P probably benign Het
Nme9 G A 9: 99,470,857 A287T possibly damaging Het
Nmrk1 A G 19: 18,636,135 I8V probably benign Het
Noa1 T C 5: 77,309,390 N223D not run Het
Nr4a3 T C 4: 48,051,269 Y8H probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr1181 T C 2: 88,423,926 Y33C probably damaging Het
Olfr124 A T 17: 37,805,163 Q6L probably benign Het
Olfr25 T C 9: 38,329,716 V40A possibly damaging Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Olfr649 T C 7: 104,190,187 S7G probably benign Het
Olfr733 T C 14: 50,299,241 I23V probably benign Het
Olfr847 C T 9: 19,375,558 A108T probably benign Het
Otoa T A 7: 121,134,044 H711Q probably benign Het
Otogl T A 10: 107,777,120 E2048D probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pcdha3 A G 18: 36,948,166 T654A probably benign Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Ppt1 T A 4: 122,836,333 H26Q probably benign Het
Prim1 T C 10: 128,026,589 probably null Het
Prmt7 G T 8: 106,237,286 A271S probably benign Het
Ptprd T C 4: 76,128,916 D124G probably benign Het
Rad54l2 T C 9: 106,713,578 K450E probably benign Het
Rasgrp2 G T 19: 6,401,827 V13L probably damaging Het
Sapcd2 A G 2: 25,375,966 probably null Het
Siglecf A G 7: 43,351,770 Y54C probably damaging Het
Timm23 A C 14: 32,198,978 Y52* probably null Het
Tm9sf1 A T 14: 55,636,335 F569I probably damaging Het
Tmprss9 C A 10: 80,893,009 A592E probably damaging Het
Trim30d A T 7: 104,472,347 V397E probably benign Het
Tshz1 A T 18: 84,016,075 N69K probably damaging Het
Upk2 A C 9: 44,453,511 S130R probably damaging Het
Vmn1r80 A G 7: 12,193,050 Y29C probably damaging Het
Vmn2r96 T C 17: 18,573,487 I31T probably benign Het
Zfp975 T C 7: 42,662,424 Q255R probably benign Het
Other mutations in Stk31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Stk31 APN 6 49437443 missense probably benign 0.41
IGL02479:Stk31 APN 6 49421688 missense probably damaging 0.99
IGL02490:Stk31 APN 6 49417535 missense probably benign 0.04
IGL03165:Stk31 APN 6 49445264 missense probably damaging 0.98
3-1:Stk31 UTSW 6 49417202 nonsense probably null
R0016:Stk31 UTSW 6 49437377 missense probably damaging 1.00
R0016:Stk31 UTSW 6 49437377 missense probably damaging 1.00
R0039:Stk31 UTSW 6 49442258 missense probably damaging 1.00
R0616:Stk31 UTSW 6 49423485 missense probably damaging 1.00
R0732:Stk31 UTSW 6 49417495 missense probably benign 0.00
R0975:Stk31 UTSW 6 49423409 missense probably damaging 1.00
R1127:Stk31 UTSW 6 49409207 missense probably damaging 1.00
R1705:Stk31 UTSW 6 49423384 missense possibly damaging 0.94
R1711:Stk31 UTSW 6 49469304 missense probably benign 0.10
R1892:Stk31 UTSW 6 49438474 missense probably damaging 1.00
R1942:Stk31 UTSW 6 49439127 missense probably damaging 0.98
R1953:Stk31 UTSW 6 49446478 critical splice donor site probably null
R2149:Stk31 UTSW 6 49439218 missense possibly damaging 0.80
R2281:Stk31 UTSW 6 49417250 missense probably damaging 1.00
R3438:Stk31 UTSW 6 49437521 missense probably benign 0.00
R4681:Stk31 UTSW 6 49437435 missense probably benign 0.37
R5333:Stk31 UTSW 6 49469152 missense probably benign 0.00
R5492:Stk31 UTSW 6 49398243 missense probably damaging 1.00
R5782:Stk31 UTSW 6 49469136 missense probably benign 0.00
R5820:Stk31 UTSW 6 49417285 missense probably damaging 0.96
R5931:Stk31 UTSW 6 49469302 missense probably benign 0.05
R6012:Stk31 UTSW 6 49469309 missense probably damaging 0.96
R6254:Stk31 UTSW 6 49421697 missense probably benign 0.08
R6281:Stk31 UTSW 6 49469180 missense possibly damaging 0.93
R6294:Stk31 UTSW 6 49417344 missense probably benign 0.18
R6401:Stk31 UTSW 6 49423438 missense probably damaging 1.00
R7289:Stk31 UTSW 6 49438459 missense probably benign 0.05
R7490:Stk31 UTSW 6 49439232 critical splice donor site probably null
Z1088:Stk31 UTSW 6 49417188 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCACTCTTTGGGCCAAGCA -3'
(R):5'- AGTGTTGGTCAGATGTGGAAATG -3'

Sequencing Primer
(F):5'- CTCTTTGGGCCAAGCATATTTAAACC -3'
(R):5'- TGGAACTCACTCTGTAGACCAGG -3'
Posted On2019-11-12