Incidental Mutation 'R7659:Vmn1r80'
ID591434
Institutional Source Beutler Lab
Gene Symbol Vmn1r80
Ensembl Gene ENSMUSG00000115744
Gene Namevomeronasal 1 receptor 80
SynonymsV1rg3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R7659 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location12189286-12203313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12193050 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 29 (Y29C)
Ref Sequence ENSEMBL: ENSMUSP00000074564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075053] [ENSMUST00000227205] [ENSMUST00000227471] [ENSMUST00000227755] [ENSMUST00000228028] [ENSMUST00000228578]
Predicted Effect probably damaging
Transcript: ENSMUST00000075053
AA Change: Y29C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074564
Gene: ENSMUSG00000115744
AA Change: Y29C

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 5.4e-11 PFAM
Pfam:7tm_1 23 290 5.3e-7 PFAM
Pfam:V1R 31 298 3e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227205
AA Change: Y29C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000227471
AA Change: Y29C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227755
AA Change: Y29C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000228028
AA Change: Y29C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000228578
AA Change: Y29C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh2 T C 5: 121,568,960 E498G probably damaging Het
Ankar T C 1: 72,690,135 T284A possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp6v0a4 A G 6: 38,071,972 I452T probably damaging Het
Azgp1 G T 5: 137,987,513 A133S probably damaging Het
Bmp2k T C 5: 97,074,719 S667P unknown Het
C1qtnf9 T A 14: 60,772,304 I3N possibly damaging Het
C530025M09Rik T G 2: 149,830,619 T199P unknown Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Cass4 A G 2: 172,427,027 D343G probably damaging Het
Ccdc84 T C 9: 44,413,493 E164G probably damaging Het
Col6a3 T A 1: 90,781,745 T2517S unknown Het
Dbr1 A G 9: 99,576,610 T78A probably damaging Het
Dnah9 A G 11: 65,989,780 F2664L probably damaging Het
Eif2ak1 T C 5: 143,889,462 I431T probably damaging Het
Got1 A G 19: 43,504,639 V281A probably benign Het
Gpld1 A C 13: 24,979,981 R555S probably benign Het
Gpr149 T C 3: 62,603,835 R248G probably benign Het
Hps3 G A 3: 20,022,814 R395* probably null Het
Inpp5b T C 4: 124,795,426 L833P probably damaging Het
Itgb4 A T 11: 115,979,731 S129C probably damaging Het
Kif1a T A 1: 93,046,820 probably benign Het
Lgr4 T A 2: 109,996,766 V205E probably damaging Het
Mbd3 T C 10: 80,395,185 N96S probably damaging Het
Mcam T A 9: 44,136,770 C136S unknown Het
Mki67 A G 7: 135,697,426 S1960P probably damaging Het
Mogs G A 6: 83,116,825 probably null Het
Muc6 T C 7: 141,637,060 T2567A possibly damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Nae1 A G 8: 104,516,164 V432A probably benign Het
Nav3 T G 10: 109,766,990 T1233P probably benign Het
Nme9 G A 9: 99,470,857 A287T possibly damaging Het
Nmrk1 A G 19: 18,636,135 I8V probably benign Het
Noa1 T C 5: 77,309,390 N223D not run Het
Nr4a3 T C 4: 48,051,269 Y8H probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr1181 T C 2: 88,423,926 Y33C probably damaging Het
Olfr124 A T 17: 37,805,163 Q6L probably benign Het
Olfr25 T C 9: 38,329,716 V40A possibly damaging Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Olfr649 T C 7: 104,190,187 S7G probably benign Het
Olfr733 T C 14: 50,299,241 I23V probably benign Het
Olfr847 C T 9: 19,375,558 A108T probably benign Het
Otoa T A 7: 121,134,044 H711Q probably benign Het
Otogl T A 10: 107,777,120 E2048D probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pcdha3 A G 18: 36,948,166 T654A probably benign Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Ppt1 T A 4: 122,836,333 H26Q probably benign Het
Prim1 T C 10: 128,026,589 probably null Het
Prmt7 G T 8: 106,237,286 A271S probably benign Het
Ptprd T C 4: 76,128,916 D124G probably benign Het
Rad54l2 T C 9: 106,713,578 K450E probably benign Het
Rasgrp2 G T 19: 6,401,827 V13L probably damaging Het
Sapcd2 A G 2: 25,375,966 probably null Het
Siglecf A G 7: 43,351,770 Y54C probably damaging Het
Stk31 T A 6: 49,423,406 N388K probably benign Het
Timm23 A C 14: 32,198,978 Y52* probably null Het
Tm9sf1 A T 14: 55,636,335 F569I probably damaging Het
Tmprss9 C A 10: 80,893,009 A592E probably damaging Het
Trim30d A T 7: 104,472,347 V397E probably benign Het
Tshz1 A T 18: 84,016,075 N69K probably damaging Het
Upk2 A C 9: 44,453,511 S130R probably damaging Het
Vmn2r96 T C 17: 18,573,487 I31T probably benign Het
Zfp975 T C 7: 42,662,424 Q255R probably benign Het
Other mutations in Vmn1r80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Vmn1r80 APN 7 12193380 missense possibly damaging 0.69
IGL01652:Vmn1r80 APN 7 12193136 missense probably benign 0.19
IGL02102:Vmn1r80 APN 7 12193691 missense probably damaging 1.00
IGL02165:Vmn1r80 APN 7 12193452 missense probably benign 0.31
IGL02328:Vmn1r80 APN 7 12193478 missense probably benign 0.12
IGL02336:Vmn1r80 APN 7 12193254 missense probably benign 0.23
IGL02606:Vmn1r80 APN 7 12193032 missense probably damaging 1.00
R0310:Vmn1r80 UTSW 7 12193848 missense probably benign 0.00
R0399:Vmn1r80 UTSW 7 12193317 missense possibly damaging 0.88
R1983:Vmn1r80 UTSW 7 12193661 missense probably benign 0.01
R2079:Vmn1r80 UTSW 7 12193194 missense probably damaging 1.00
R4278:Vmn1r80 UTSW 7 12193527 missense probably benign 0.00
R4501:Vmn1r80 UTSW 7 12193391 missense probably benign 0.39
R5894:Vmn1r80 UTSW 7 12193727 missense probably damaging 0.99
R5991:Vmn1r80 UTSW 7 12193496 missense probably benign 0.09
R6552:Vmn1r80 UTSW 7 12193757 missense probably damaging 0.98
R7560:Vmn1r80 UTSW 7 12193823 missense probably damaging 0.98
R8313:Vmn1r80 UTSW 7 12193067 missense probably benign 0.00
Z1189:Vmn1r80 UTSW 7 12193433 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCCAAATCATTGTGTTTGGTC -3'
(R):5'- TAGACACATAGCATAAAGGGACATC -3'

Sequencing Primer
(F):5'- AATTCTGTAGATCAGGCTAGCCTC -3'
(R):5'- GGACATCCCCCTTGTTATTCTG -3'
Posted On2019-11-12