Incidental Mutation 'R7659:Or7g29'
ID 591444
Institutional Source Beutler Lab
Gene Symbol Or7g29
Ensembl Gene ENSMUSG00000059821
Gene Name olfactory receptor family 7 subfamily G member 29
Synonyms Olfr847, GA_x6K02T2PVTD-13113073-13112135, MOR149-2
MMRRC Submission 045734-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R7659 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 19286237-19287175 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 19286854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 108 (A108T)
Ref Sequence ENSEMBL: ENSMUSP00000151112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079620] [ENSMUST00000216839]
AlphaFold Q8VFF4
Predicted Effect probably benign
Transcript: ENSMUST00000079620
AA Change: A108T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000078568
Gene: ENSMUSG00000059821
AA Change: A108T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.9e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216839
AA Change: A108T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh2 T C 5: 121,707,023 (GRCm39) E498G probably damaging Het
Ankar T C 1: 72,729,294 (GRCm39) T284A possibly damaging Het
Arid5b C T 10: 67,934,417 (GRCm39) G495E probably benign Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atp6v0a4 A G 6: 38,048,907 (GRCm39) I452T probably damaging Het
Azgp1 G T 5: 137,985,775 (GRCm39) A133S probably damaging Het
Bmp2k T C 5: 97,222,578 (GRCm39) S667P unknown Het
C1qtnf9 T A 14: 61,009,753 (GRCm39) I3N possibly damaging Het
C530025M09Rik T G 2: 149,672,539 (GRCm39) T199P unknown Het
Casc3 C G 11: 98,700,699 (GRCm39) R4G unknown Het
Cass4 A G 2: 172,268,947 (GRCm39) D343G probably damaging Het
Cenatac T C 9: 44,324,790 (GRCm39) E164G probably damaging Het
Col6a3 T A 1: 90,709,467 (GRCm39) T2517S unknown Het
Dbr1 A G 9: 99,458,663 (GRCm39) T78A probably damaging Het
Dnah9 A G 11: 65,880,606 (GRCm39) F2664L probably damaging Het
Eif2ak1 T C 5: 143,826,280 (GRCm39) I431T probably damaging Het
Got1 A G 19: 43,493,078 (GRCm39) V281A probably benign Het
Gpld1 A C 13: 25,163,964 (GRCm39) R555S probably benign Het
Gpr149 T C 3: 62,511,256 (GRCm39) R248G probably benign Het
Hps3 G A 3: 20,076,978 (GRCm39) R395* probably null Het
Inpp5b T C 4: 124,689,219 (GRCm39) L833P probably damaging Het
Itgb4 A T 11: 115,870,557 (GRCm39) S129C probably damaging Het
Kif1a T A 1: 92,974,542 (GRCm39) probably benign Het
Lgr4 T A 2: 109,827,111 (GRCm39) V205E probably damaging Het
Mbd3 T C 10: 80,231,019 (GRCm39) N96S probably damaging Het
Mcam T A 9: 44,048,067 (GRCm39) C136S unknown Het
Mki67 A G 7: 135,299,155 (GRCm39) S1960P probably damaging Het
Mogs G A 6: 83,093,806 (GRCm39) probably null Het
Muc6 T C 7: 141,216,973 (GRCm39) T2567A possibly damaging Het
Mug1 C A 6: 121,838,179 (GRCm39) H470N possibly damaging Het
Nae1 A G 8: 105,242,796 (GRCm39) V432A probably benign Het
Nav3 T G 10: 109,602,851 (GRCm39) T1233P probably benign Het
Nme9 G A 9: 99,352,910 (GRCm39) A287T possibly damaging Het
Nmrk1 A G 19: 18,613,499 (GRCm39) I8V probably benign Het
Noa1 T C 5: 77,457,237 (GRCm39) N223D not run Het
Nr4a3 T C 4: 48,051,269 (GRCm39) Y8H probably damaging Het
Or12e1 T A 2: 87,022,709 (GRCm39) V226E possibly damaging Het
Or1j15 T A 2: 36,458,637 (GRCm39) V9E possibly damaging Het
Or2b4 A T 17: 38,116,054 (GRCm39) Q6L probably benign Het
Or4n4b T C 14: 50,536,698 (GRCm39) I23V probably benign Het
Or4p20 T C 2: 88,254,270 (GRCm39) Y33C probably damaging Het
Or52h2 T C 7: 103,839,394 (GRCm39) S7G probably benign Het
Or8c9 T C 9: 38,241,012 (GRCm39) V40A possibly damaging Het
Otoa T A 7: 120,733,267 (GRCm39) H711Q probably benign Het
Otogl T A 10: 107,612,981 (GRCm39) E2048D probably benign Het
Paip1 C T 13: 119,587,306 (GRCm39) T390I possibly damaging Het
Pcdha3 A G 18: 37,081,219 (GRCm39) T654A probably benign Het
Pigg G A 5: 108,486,485 (GRCm39) V713I probably benign Het
Ppt1 T A 4: 122,730,126 (GRCm39) H26Q probably benign Het
Prim1 T C 10: 127,862,458 (GRCm39) probably null Het
Prmt7 G T 8: 106,963,918 (GRCm39) A271S probably benign Het
Ptprd T C 4: 76,047,153 (GRCm39) D124G probably benign Het
Rad54l2 T C 9: 106,590,777 (GRCm39) K450E probably benign Het
Rasgrp2 G T 19: 6,451,857 (GRCm39) V13L probably damaging Het
Sapcd2 A G 2: 25,265,978 (GRCm39) probably null Het
Siglecf A G 7: 43,001,194 (GRCm39) Y54C probably damaging Het
Stk31 T A 6: 49,400,340 (GRCm39) N388K probably benign Het
Timm23 A C 14: 31,920,935 (GRCm39) Y52* probably null Het
Tm9sf1 A T 14: 55,873,792 (GRCm39) F569I probably damaging Het
Tmprss9 C A 10: 80,728,843 (GRCm39) A592E probably damaging Het
Trim30d A T 7: 104,121,554 (GRCm39) V397E probably benign Het
Tshz1 A T 18: 84,034,200 (GRCm39) N69K probably damaging Het
Upk2 A C 9: 44,364,808 (GRCm39) S130R probably damaging Het
Vmn1r80 A G 7: 11,926,977 (GRCm39) Y29C probably damaging Het
Vmn2r96 T C 17: 18,793,749 (GRCm39) I31T probably benign Het
Zfp975 T C 7: 42,311,848 (GRCm39) Q255R probably benign Het
Other mutations in Or7g29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Or7g29 APN 9 19,286,535 (GRCm39) missense probably damaging 1.00
IGL01293:Or7g29 APN 9 19,286,632 (GRCm39) missense probably benign 0.23
IGL01879:Or7g29 APN 9 19,286,703 (GRCm39) nonsense probably null
IGL03298:Or7g29 APN 9 19,286,358 (GRCm39) missense probably damaging 1.00
R1350:Or7g29 UTSW 9 19,286,710 (GRCm39) missense possibly damaging 0.94
R1400:Or7g29 UTSW 9 19,286,358 (GRCm39) missense probably damaging 0.98
R2894:Or7g29 UTSW 9 19,286,588 (GRCm39) nonsense probably null
R4468:Or7g29 UTSW 9 19,286,944 (GRCm39) missense probably benign 0.00
R4694:Or7g29 UTSW 9 19,286,694 (GRCm39) missense probably damaging 1.00
R4791:Or7g29 UTSW 9 19,287,105 (GRCm39) missense probably benign 0.28
R4794:Or7g29 UTSW 9 19,286,841 (GRCm39) missense probably benign 0.00
R5517:Or7g29 UTSW 9 19,287,063 (GRCm39) missense probably damaging 1.00
R5599:Or7g29 UTSW 9 19,286,925 (GRCm39) missense possibly damaging 0.77
R5777:Or7g29 UTSW 9 19,287,014 (GRCm39) missense probably benign 0.29
R6505:Or7g29 UTSW 9 19,286,237 (GRCm39) makesense probably null
R6509:Or7g29 UTSW 9 19,286,439 (GRCm39) missense probably benign
R7246:Or7g29 UTSW 9 19,286,761 (GRCm39) nonsense probably null
R7789:Or7g29 UTSW 9 19,286,361 (GRCm39) missense probably benign 0.33
R7886:Or7g29 UTSW 9 19,287,202 (GRCm39) splice site probably null
R8948:Or7g29 UTSW 9 19,286,262 (GRCm39) missense probably benign 0.03
R9326:Or7g29 UTSW 9 19,286,346 (GRCm39) missense probably damaging 1.00
R9612:Or7g29 UTSW 9 19,286,677 (GRCm39) missense possibly damaging 0.69
R9784:Or7g29 UTSW 9 19,287,116 (GRCm39) missense probably damaging 0.99
R9798:Or7g29 UTSW 9 19,286,577 (GRCm39) missense probably benign 0.30
Z1088:Or7g29 UTSW 9 19,286,980 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGCAAAATGACAACCGC -3'
(R):5'- GGTTACAATTGTGGGAAATTTGCTC -3'

Sequencing Primer
(F):5'- TGTGCAAAATGACAACCGCAGTATC -3'
(R):5'- GGGAAATTTGCTCATCATCATTGCTG -3'
Posted On 2019-11-12