Mutagenetix > Incidental Mutations

Incidental Mutation 'R7659:Nav3'

591455

Institutional Source

Beutler Lab

Gene Symbol

Nav3

Ensembl Gene

ENSMUSG00000020181

Gene Name

neuron navigator 3

Synonyms

POMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7659 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

109681259-110456204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 109766990 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 1233 (T1233P)

Ref Sequence

ENSEMBL: ENSMUSP00000032719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032719]

Predicted Effect

probably benign
Transcript: ENSMUST00000032719
AA Change: T1233P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: T1233P

Domain	Start	End	E-Value	Type
CH	79	182	4.41e-12	SMART
low complexity region	184	194	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	353	363	N/A	INTRINSIC
low complexity region	427	439	N/A	INTRINSIC
low complexity region	522	536	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	873	896	N/A	INTRINSIC
low complexity region	904	916	N/A	INTRINSIC
low complexity region	1077	1095	N/A	INTRINSIC
low complexity region	1160	1173	N/A	INTRINSIC
low complexity region	1207	1229	N/A	INTRINSIC
low complexity region	1256	1266	N/A	INTRINSIC
low complexity region	1274	1285	N/A	INTRINSIC
low complexity region	1293	1312	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
low complexity region	1462	1474	N/A	INTRINSIC
low complexity region	1550	1563	N/A	INTRINSIC
coiled coil region	1565	1656	N/A	INTRINSIC
low complexity region	1675	1692	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
low complexity region	1756	1781	N/A	INTRINSIC
low complexity region	1782	1795	N/A	INTRINSIC
coiled coil region	1801	1842	N/A	INTRINSIC
low complexity region	1848	1871	N/A	INTRINSIC
AAA	2029	2184	4.94e-7	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh2	T	C	5: 121,568,960	E498G	probably damaging	Het
Ankar	T	C	1: 72,690,135	T284A	possibly damaging	Het
Arid5b	C	T	10: 68,098,587	G495E	probably benign	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atp6v0a4	A	G	6: 38,071,972	I452T	probably damaging	Het
Azgp1	G	T	5: 137,987,513	A133S	probably damaging	Het
Bmp2k	T	C	5: 97,074,719	S667P	unknown	Het
C1qtnf9	T	A	14: 60,772,304	I3N	possibly damaging	Het
C530025M09Rik	T	G	2: 149,830,619	T199P	unknown	Het
Casc3	C	G	11: 98,809,873	R4G	unknown	Het
Cass4	A	G	2: 172,427,027	D343G	probably damaging	Het
Ccdc84	T	C	9: 44,413,493	E164G	probably damaging	Het
Col6a3	T	A	1: 90,781,745	T2517S	unknown	Het
Dbr1	A	G	9: 99,576,610	T78A	probably damaging	Het
Dnah9	A	G	11: 65,989,780	F2664L	probably damaging	Het
Eif2ak1	T	C	5: 143,889,462	I431T	probably damaging	Het
Got1	A	G	19: 43,504,639	V281A	probably benign	Het
Gpld1	A	C	13: 24,979,981	R555S	probably benign	Het
Gpr149	T	C	3: 62,603,835	R248G	probably benign	Het
Hps3	G	A	3: 20,022,814	R395*	probably null	Het
Inpp5b	T	C	4: 124,795,426	L833P	probably damaging	Het
Itgb4	A	T	11: 115,979,731	S129C	probably damaging	Het
Lgr4	T	A	2: 109,996,766	V205E	probably damaging	Het
Mbd3	T	C	10: 80,395,185	N96S	probably damaging	Het
Mki67	A	G	7: 135,697,426	S1960P	probably damaging	Het
Mogs	G	A	6: 83,116,825		probably null	Het
Muc6	T	C	7: 141,637,060	T2567A	possibly damaging	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Nae1	A	G	8: 104,516,164	V432A	probably benign	Het
Nme9	G	A	9: 99,470,857	A287T	possibly damaging	Het
Nmrk1	A	G	19: 18,636,135	I8V	probably benign	Het
Noa1	T	C	5: 77,309,390	N223D	not run	Het
Nr4a3	T	C	4: 48,051,269	Y8H	probably damaging	Het
Olfr1112	T	A	2: 87,192,365	V226E	possibly damaging	Het
Olfr1181	T	C	2: 88,423,926	Y33C	probably damaging	Het
Olfr124	A	T	17: 37,805,163	Q6L	probably benign	Het
Olfr25	T	C	9: 38,329,716	V40A	possibly damaging	Het
Olfr344	T	A	2: 36,568,625	V9E	possibly damaging	Het
Olfr649	T	C	7: 104,190,187	S7G	probably benign	Het
Olfr733	T	C	14: 50,299,241	I23V	probably benign	Het
Olfr847	C	T	9: 19,375,558	A108T	probably benign	Het
Otoa	T	A	7: 121,134,044	H711Q	probably benign	Het
Otogl	T	A	10: 107,777,120	E2048D	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pcdha3	A	G	18: 36,948,166	T654A	probably benign	Het
Pigg	G	A	5: 108,338,619	V713I	probably benign	Het
Ppt1	T	A	4: 122,836,333	H26Q	probably benign	Het
Prim1	T	C	10: 128,026,589		probably null	Het
Prmt7	G	T	8: 106,237,286	A271S	probably benign	Het
Ptprd	T	C	4: 76,128,916	D124G	probably benign	Het
Rad54l2	T	C	9: 106,713,578	K450E	probably benign	Het
Rasgrp2	G	T	19: 6,401,827	V13L	probably damaging	Het
Sapcd2	A	G	2: 25,375,966		probably null	Het
Siglecf	A	G	7: 43,351,770	Y54C	probably damaging	Het
Stk31	T	A	6: 49,423,406	N388K	probably benign	Het
Timm23	A	C	14: 32,198,978	Y52*	probably null	Het
Tm9sf1	A	T	14: 55,636,335	F569I	probably damaging	Het
Tmprss9	C	A	10: 80,893,009	A592E	probably damaging	Het
Trim30d	A	T	7: 104,472,347	V397E	probably benign	Het
Tshz1	A	T	18: 84,016,075	N69K	probably damaging	Het
Upk2	A	C	9: 44,453,511	S130R	probably damaging	Het
Vmn1r80	A	G	7: 12,193,050	Y29C	probably damaging	Het
Vmn2r96	T	C	17: 18,573,487	I31T	probably benign	Het
Zfp975	T	C	7: 42,662,424	Q255R	probably benign	Het

Other mutations in Nav3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Nav3	APN	10	109841733	missense	probably damaging	0.99
IGL00425:Nav3	APN	10	109703507	missense	probably benign	0.13
IGL00465:Nav3	APN	10	109852746	missense	probably damaging	0.99
IGL00531:Nav3	APN	10	109703310	missense	probably null	0.99
IGL00575:Nav3	APN	10	109764765	missense	probably damaging	0.98
IGL00770:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00774:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00858:Nav3	APN	10	109742632	missense	probably damaging	0.98
IGL00935:Nav3	APN	10	109705666	missense	probably benign
IGL01638:Nav3	APN	10	109852863	missense	probably damaging	1.00
IGL01662:Nav3	APN	10	109769258	missense	possibly damaging	0.56
IGL01670:Nav3	APN	10	109714241	missense	possibly damaging	0.92
IGL01885:Nav3	APN	10	109742660	nonsense	probably null
IGL01979:Nav3	APN	10	109704929	missense	probably benign	0.01
IGL02121:Nav3	APN	10	109759036	missense	probably damaging	0.99
IGL02210:Nav3	APN	10	109766990	missense	probably benign
IGL02523:Nav3	APN	10	109769296	missense	probably damaging	1.00
IGL02573:Nav3	APN	10	109866974	missense	probably benign	0.23
IGL02633:Nav3	APN	10	109692136	missense	probably benign	0.09
IGL02810:Nav3	APN	10	109816274	missense	probably damaging	1.00
IGL02964:Nav3	APN	10	109736953	missense	probably damaging	0.99
IGL03015:Nav3	APN	10	109718297	missense	probably damaging	0.98
IGL03288:Nav3	APN	10	109759017	missense	probably damaging	1.00
IGL03310:Nav3	APN	10	109824572	critical splice donor site	probably null
PIT4377001:Nav3	UTSW	10	109716605	missense	probably damaging	0.99
R0010:Nav3	UTSW	10	109823226	splice site	probably benign
R0043:Nav3	UTSW	10	109767518	missense	possibly damaging	0.95
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0077:Nav3	UTSW	10	109716642	missense	possibly damaging	0.87
R0219:Nav3	UTSW	10	109866930	critical splice donor site	probably null
R0310:Nav3	UTSW	10	109767128	missense	possibly damaging	0.82
R0380:Nav3	UTSW	10	109758879	splice site	probably benign
R0403:Nav3	UTSW	10	109767103	missense	probably damaging	0.98
R0480:Nav3	UTSW	10	109853300	missense	probably damaging	1.00
R0626:Nav3	UTSW	10	109823464	missense	probably damaging	1.00
R0637:Nav3	UTSW	10	109770197	missense	probably benign	0.25
R0847:Nav3	UTSW	10	109903857	missense	possibly damaging	0.94
R0988:Nav3	UTSW	10	109716528	missense	probably damaging	1.00
R1272:Nav3	UTSW	10	109736999	missense	probably damaging	0.98
R1295:Nav3	UTSW	10	109692102	missense	probably damaging	1.00
R1405:Nav3	UTSW	10	109770333	splice site	probably benign
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1420:Nav3	UTSW	10	109823254	missense	probably benign	0.02
R1449:Nav3	UTSW	10	109853511	missense	probably benign	0.13
R1458:Nav3	UTSW	10	109720044	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1472:Nav3	UTSW	10	109727941	missense	probably damaging	0.99
R1537:Nav3	UTSW	10	109866985	missense	probably damaging	1.00
R1539:Nav3	UTSW	10	109767170	missense	probably damaging	0.99
R1581:Nav3	UTSW	10	109823428	missense	probably damaging	1.00
R1586:Nav3	UTSW	10	109853254	missense	probably damaging	1.00
R1654:Nav3	UTSW	10	109853123	missense	possibly damaging	0.85
R1725:Nav3	UTSW	10	109823590	missense	probably damaging	1.00
R1742:Nav3	UTSW	10	109769213	missense	probably benign
R1793:Nav3	UTSW	10	109703372	missense	probably benign	0.00
R1830:Nav3	UTSW	10	109823323	missense	probably damaging	1.00
R1834:Nav3	UTSW	10	109720022	missense	probably damaging	0.99
R1881:Nav3	UTSW	10	109852559	missense	probably damaging	0.96
R1922:Nav3	UTSW	10	109705606	missense	probably benign	0.43
R1944:Nav3	UTSW	10	109716530	missense	probably damaging	0.99
R1981:Nav3	UTSW	10	109719090	splice site	probably benign
R1985:Nav3	UTSW	10	109770184	splice site	probably benign
R1996:Nav3	UTSW	10	109853401	missense	probably damaging	1.00
R2051:Nav3	UTSW	10	109824675	missense	probably damaging	0.99
R2062:Nav3	UTSW	10	109720021	missense	probably damaging	1.00
R2139:Nav3	UTSW	10	109853135	missense	probably benign	0.22
R2248:Nav3	UTSW	10	109696227	missense	probably damaging	1.00
R2420:Nav3	UTSW	10	109863813	missense	probably damaging	0.98
R2444:Nav3	UTSW	10	109764915	missense	probably benign	0.09
R3026:Nav3	UTSW	10	109824604	missense	probably damaging	0.99
R3052:Nav3	UTSW	10	109903752	missense	probably damaging	0.99
R3441:Nav3	UTSW	10	109704928	missense	probably benign	0.01
R3845:Nav3	UTSW	10	109853376	missense	possibly damaging	0.82
R3929:Nav3	UTSW	10	109684203	missense	probably damaging	1.00
R3932:Nav3	UTSW	10	109694035	missense	probably damaging	0.99
R4056:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4057:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4120:Nav3	UTSW	10	109903744	critical splice donor site	probably null
R4244:Nav3	UTSW	10	109769296	missense	probably damaging	1.00
R4361:Nav3	UTSW	10	109852986	missense	probably damaging	1.00
R4512:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4514:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4700:Nav3	UTSW	10	109764935	missense	probably benign	0.10
R4815:Nav3	UTSW	10	109823552	missense	probably benign
R4981:Nav3	UTSW	10	109880692	missense	probably benign
R5042:Nav3	UTSW	10	109769268	missense	probably benign	0.27
R5251:Nav3	UTSW	10	109853253	missense	probably damaging	0.99
R5252:Nav3	UTSW	10	109714291	small deletion	probably benign
R5273:Nav3	UTSW	10	109693038	critical splice donor site	probably null
R5288:Nav3	UTSW	10	109853105	missense	probably benign	0.10
R5407:Nav3	UTSW	10	109866935	missense	probably benign	0.28
R5533:Nav3	UTSW	10	109883678	missense	possibly damaging	0.61
R5561:Nav3	UTSW	10	109716552	missense	probably damaging	1.00
R5577:Nav3	UTSW	10	109769403	missense	probably damaging	1.00
R5656:Nav3	UTSW	10	109764633	missense	probably damaging	0.96
R5872:Nav3	UTSW	10	109764787	missense	probably damaging	1.00
R6023:Nav3	UTSW	10	109823515	missense	possibly damaging	0.95
R6061:Nav3	UTSW	10	109866984	nonsense	probably null
R6189:Nav3	UTSW	10	109720019	missense	probably damaging	0.98
R6214:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6215:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6264:Nav3	UTSW	10	109688833	missense	probably damaging	0.97
R6500:Nav3	UTSW	10	109764756	missense	probably damaging	1.00
R6524:Nav3	UTSW	10	109720030	missense	probably damaging	0.99
R6868:Nav3	UTSW	10	109693166	missense	possibly damaging	0.49
R7079:Nav3	UTSW	10	109767292	missense	probably benign	0.16
R7099:Nav3	UTSW	10	109703334	missense	probably benign	0.11
R7139:Nav3	UTSW	10	109853477	missense	probably benign	0.44
R7238:Nav3	UTSW	10	109853324	missense	possibly damaging	0.75
R7338:Nav3	UTSW	10	109769212	missense	probably benign	0.04
R7343:Nav3	UTSW	10	109903758	missense	probably damaging	0.98
R7383:Nav3	UTSW	10	109716671	missense	probably damaging	0.98
R7391:Nav3	UTSW	10	109703456	missense	probably benign	0.07
R7399:Nav3	UTSW	10	109852934	missense	possibly damaging	0.74
R7457:Nav3	UTSW	10	109696328	nonsense	probably null
R7462:Nav3	UTSW	10	109823578	missense	probably damaging	1.00
R7542:Nav3	UTSW	10	109823533	missense	possibly damaging	0.89
R7749:Nav3	UTSW	10	109703352	missense	probably damaging	0.99
R7794:Nav3	UTSW	10	109688856	missense	probably benign	0.08
X0012:Nav3	UTSW	10	109692097	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTTTTACACTAGCAACAGGTG -3'
(R):5'- TCCAATGTCAGCAGCAAGTC -3'

Sequencing Primer
(F):5'- CAGGTGCAATCAGCAAA -3'
(R):5'- AGCAAGTCAGCTGGGGC -3'

Posted On

2019-11-12