Incidental Mutation 'R7659:Casc3'
ID591458
Institutional Source Beutler Lab
Gene Symbol Casc3
Ensembl Gene ENSMUSG00000078676
Gene Namecancer susceptibility candidate 3
SynonymsBtz, Mln51
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R7659 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98804905-98833814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 98809873 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 4 (R4G)
Ref Sequence ENSEMBL: ENSMUSP00000130926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017384] [ENSMUST00000037915] [ENSMUST00000037930] [ENSMUST00000107487] [ENSMUST00000169695]
Predicted Effect unknown
Transcript: ENSMUST00000017384
AA Change: R4G
SMART Domains Protein: ENSMUSP00000017384
Gene: ENSMUSG00000078676
AA Change: R4G

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037915
SMART Domains Protein: ENSMUSP00000042792
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
Pfam:MSL1_dimer 216 252 5e-22 PFAM
low complexity region 289 300 N/A INTRINSIC
low complexity region 441 453 N/A INTRINSIC
PEHE 475 593 1.8e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037930
SMART Domains Protein: ENSMUSP00000043328
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
coiled coil region 18 56 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 211 223 N/A INTRINSIC
PEHE 229 347 2.73e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107487
SMART Domains Protein: ENSMUSP00000103111
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
SCOP:d1fxkc_ 235 307 6e-3 SMART
low complexity region 441 453 N/A INTRINSIC
PEHE 459 577 2.73e-41 SMART
Predicted Effect unknown
Transcript: ENSMUST00000169695
AA Change: R4G
SMART Domains Protein: ENSMUSP00000130926
Gene: ENSMUSG00000078676
AA Change: R4G

DomainStartEndE-ValueType
low complexity region 18 62 N/A INTRINSIC
low complexity region 64 84 N/A INTRINSIC
low complexity region 89 109 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Btz 138 246 1.02e-57 SMART
low complexity region 524 533 N/A INTRINSIC
low complexity region 586 614 N/A INTRINSIC
low complexity region 627 648 N/A INTRINSIC
low complexity region 669 684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a core component of the exon junction complex (EJC), a protein complex that is deposited on spliced mRNAs at exon-exon junctions and functions in nonsense-mediated mRNA decay (NMD). The encoded protein binds RNA and interacts with two other EJC core components. It is predominantly located in the cytoplasm, but shuttles into the nucleus where it localizes to nuclear speckles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygosity for a null or hypomorphic allele causes embryonic and postnatal lethality, respectively. Compound heterozygous embryos are smaller and exhibit proportionately reduced brain size with fewer neurons and progenitors, but no apoptosis, largely due to developmental delay. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh2 T C 5: 121,568,960 E498G probably damaging Het
Ankar T C 1: 72,690,135 T284A possibly damaging Het
Arid5b C T 10: 68,098,587 G495E probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atp6v0a4 A G 6: 38,071,972 I452T probably damaging Het
Azgp1 G T 5: 137,987,513 A133S probably damaging Het
Bmp2k T C 5: 97,074,719 S667P unknown Het
C1qtnf9 T A 14: 60,772,304 I3N possibly damaging Het
C530025M09Rik T G 2: 149,830,619 T199P unknown Het
Cass4 A G 2: 172,427,027 D343G probably damaging Het
Ccdc84 T C 9: 44,413,493 E164G probably damaging Het
Col6a3 T A 1: 90,781,745 T2517S unknown Het
Dbr1 A G 9: 99,576,610 T78A probably damaging Het
Dnah9 A G 11: 65,989,780 F2664L probably damaging Het
Eif2ak1 T C 5: 143,889,462 I431T probably damaging Het
Got1 A G 19: 43,504,639 V281A probably benign Het
Gpld1 A C 13: 24,979,981 R555S probably benign Het
Gpr149 T C 3: 62,603,835 R248G probably benign Het
Hps3 G A 3: 20,022,814 R395* probably null Het
Inpp5b T C 4: 124,795,426 L833P probably damaging Het
Itgb4 A T 11: 115,979,731 S129C probably damaging Het
Kif1a T A 1: 93,046,820 probably benign Het
Lgr4 T A 2: 109,996,766 V205E probably damaging Het
Mbd3 T C 10: 80,395,185 N96S probably damaging Het
Mcam T A 9: 44,136,770 C136S unknown Het
Mki67 A G 7: 135,697,426 S1960P probably damaging Het
Mogs G A 6: 83,116,825 probably null Het
Muc6 T C 7: 141,637,060 T2567A possibly damaging Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Nae1 A G 8: 104,516,164 V432A probably benign Het
Nav3 T G 10: 109,766,990 T1233P probably benign Het
Nme9 G A 9: 99,470,857 A287T possibly damaging Het
Nmrk1 A G 19: 18,636,135 I8V probably benign Het
Noa1 T C 5: 77,309,390 N223D not run Het
Nr4a3 T C 4: 48,051,269 Y8H probably damaging Het
Olfr1112 T A 2: 87,192,365 V226E possibly damaging Het
Olfr1181 T C 2: 88,423,926 Y33C probably damaging Het
Olfr124 A T 17: 37,805,163 Q6L probably benign Het
Olfr25 T C 9: 38,329,716 V40A possibly damaging Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Olfr649 T C 7: 104,190,187 S7G probably benign Het
Olfr733 T C 14: 50,299,241 I23V probably benign Het
Olfr847 C T 9: 19,375,558 A108T probably benign Het
Otoa T A 7: 121,134,044 H711Q probably benign Het
Otogl T A 10: 107,777,120 E2048D probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pcdha3 A G 18: 36,948,166 T654A probably benign Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Ppt1 T A 4: 122,836,333 H26Q probably benign Het
Prim1 T C 10: 128,026,589 probably null Het
Prmt7 G T 8: 106,237,286 A271S probably benign Het
Ptprd T C 4: 76,128,916 D124G probably benign Het
Rad54l2 T C 9: 106,713,578 K450E probably benign Het
Rasgrp2 G T 19: 6,401,827 V13L probably damaging Het
Sapcd2 A G 2: 25,375,966 probably null Het
Siglecf A G 7: 43,351,770 Y54C probably damaging Het
Stk31 T A 6: 49,423,406 N388K probably benign Het
Timm23 A C 14: 32,198,978 Y52* probably null Het
Tm9sf1 A T 14: 55,636,335 F569I probably damaging Het
Tmprss9 C A 10: 80,893,009 A592E probably damaging Het
Trim30d A T 7: 104,472,347 V397E probably benign Het
Tshz1 A T 18: 84,016,075 N69K probably damaging Het
Upk2 A C 9: 44,453,511 S130R probably damaging Het
Vmn1r80 A G 7: 12,193,050 Y29C probably damaging Het
Vmn2r96 T C 17: 18,573,487 I31T probably benign Het
Zfp975 T C 7: 42,662,424 Q255R probably benign Het
Other mutations in Casc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Casc3 APN 11 98823202 missense possibly damaging 0.62
IGL01566:Casc3 APN 11 98823401 critical splice donor site probably null
IGL01901:Casc3 APN 11 98823121 missense probably damaging 1.00
IGL02345:Casc3 APN 11 98827564 splice site probably benign
IGL02875:Casc3 APN 11 98821552 missense probably damaging 1.00
IGL02964:Casc3 APN 11 98828923 missense probably damaging 0.96
R0147:Casc3 UTSW 11 98822499 missense possibly damaging 0.89
R0195:Casc3 UTSW 11 98821493 missense probably damaging 0.99
R0763:Casc3 UTSW 11 98831318 missense probably damaging 1.00
R1581:Casc3 UTSW 11 98822818 missense possibly damaging 0.66
R2021:Casc3 UTSW 11 98821506 missense probably benign 0.01
R4380:Casc3 UTSW 11 98823031 missense possibly damaging 0.67
R4612:Casc3 UTSW 11 98822958 missense probably benign 0.13
R4988:Casc3 UTSW 11 98821874 intron probably null
R5079:Casc3 UTSW 11 98810426 intron probably benign
R5442:Casc3 UTSW 11 98821471 missense probably damaging 0.99
R5511:Casc3 UTSW 11 98810914 nonsense probably null
R5873:Casc3 UTSW 11 98821444 missense unknown
R6041:Casc3 UTSW 11 98828559 missense probably damaging 1.00
R6685:Casc3 UTSW 11 98822530 missense probably damaging 0.99
R7030:Casc3 UTSW 11 98822533 missense possibly damaging 0.74
R7107:Casc3 UTSW 11 98827587 missense possibly damaging 0.93
R7594:Casc3 UTSW 11 98821485 missense probably benign 0.04
R7660:Casc3 UTSW 11 98809873 missense unknown
Predicted Primers PCR Primer
(F):5'- CTCGCTCTCCAGAAAACGTG -3'
(R):5'- GCATCTCACAGCATCTCCAG -3'

Sequencing Primer
(F):5'- TCCAGAAAACGTGCCGCAG -3'
(R):5'- ACACTCAGACTCCTCGGCG -3'
Posted On2019-11-12