Incidental Mutation 'R7660:Pax8'
ID591476
Institutional Source Beutler Lab
Gene Symbol Pax8
Ensembl Gene ENSMUSG00000026976
Gene Namepaired box 8
SynonymsPax-8
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7660 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location24420560-24475599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24436561 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 263 (Y263C)
Ref Sequence ENSEMBL: ENSMUSP00000028355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028355] [ENSMUST00000136228] [ENSMUST00000149294] [ENSMUST00000153535] [ENSMUST00000153601]
Predicted Effect probably benign
Transcript: ENSMUST00000028355
AA Change: Y263C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028355
Gene: ENSMUSG00000026976
AA Change: Y263C

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 8e-5 SMART
low complexity region 311 328 N/A INTRINSIC
Pfam:Pax2_C 344 456 2.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136228
AA Change: Y264C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133316
Gene: ENSMUSG00000026976
AA Change: Y264C

DomainStartEndE-ValueType
PAX 9 134 9.13e-91 SMART
SCOP:d1fjla_ 221 248 8e-5 SMART
low complexity region 312 329 N/A INTRINSIC
Pfam:Pax2_C 342 404 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149294
AA Change: Y263C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115194
Gene: ENSMUSG00000026976
AA Change: Y263C

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153535
SMART Domains Protein: ENSMUSP00000120319
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
PAX 9 134 9.13e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153601
SMART Domains Protein: ENSMUSP00000134343
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
SCOP:d1ftt__ 23 49 1e-4 SMART
Meta Mutation Damage Score 0.2740 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors that contain a characteristic N-terminal paired DNA-binding domain. The encoded protein is important for proper differentiation of the thyroid and the kidney. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit severe hypothyroidism due to thyroid follicular cell aplasia, male infertility, deafness, ataxia, growth retardation, tiny spleens, impaired ossification of long bones and maturation of the small intestine, fatty livers, and lethality around weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,860,719 H142L possibly damaging Het
Abca13 A G 11: 9,290,678 E847G probably benign Het
Abca9 T A 11: 110,115,452 T1276S probably benign Het
Abcb11 C T 2: 69,287,594 probably null Het
AF366264 A T 8: 13,837,995 I32K probably benign Het
Alpk1 G C 3: 127,680,967 H462Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atm C T 9: 53,445,507 V2815M probably benign Het
Braf T C 6: 39,623,641 I681V possibly damaging Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Crybg1 T C 10: 43,998,835 D759G probably damaging Het
Csrp2 A G 10: 110,937,763 N103S probably benign Het
Faf1 A T 4: 109,861,837 H380L probably damaging Het
Farp1 G A 14: 121,276,922 A888T probably benign Het
Fat4 A T 3: 38,981,160 Q2987L probably benign Het
Fkbp15 T A 4: 62,314,341 T665S probably benign Het
Gigyf1 T C 5: 137,520,969 S343P probably benign Het
Glrx3 A G 7: 137,459,225 Y196C probably damaging Het
Gm3278 T G 14: 4,893,349 L66R probably damaging Het
Gm8298 A G 3: 59,865,268 I64M probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 A G 1: 174,028,248 V72A probably benign Het
Ift140 T G 17: 25,051,824 L708R probably damaging Het
Ints13 A T 6: 146,557,338 L328M probably benign Het
Itfg2 A G 6: 128,424,746 I23T probably damaging Het
Ldha C T 7: 46,850,257 P100S unknown Het
Lmtk2 T A 5: 144,148,340 L210H probably damaging Het
Lrrc4 T A 6: 28,829,817 I600L probably benign Het
Map2 C A 1: 66,414,377 P809T probably damaging Het
Matn2 A G 15: 34,402,946 K439R probably benign Het
Matn2 T A 15: 34,423,728 C577* probably null Het
Mep1a C T 17: 43,478,977 G494S probably benign Het
Mtmr4 T C 11: 87,604,580 F488L probably damaging Het
Mtus1 G T 8: 41,016,211 T8K probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mybpc1 T C 10: 88,548,854 T523A possibly damaging Het
Ncoa3 C T 2: 166,069,321 P1334S probably benign Het
Neb T G 2: 52,249,439 M119L Het
Nox4 T C 7: 87,370,022 Y408H probably damaging Het
Nxpe3 C T 16: 55,844,327 R510Q probably damaging Het
Olfr1077-ps1 A T 2: 86,525,830 S116T possibly damaging Het
Olfr1275 C T 2: 111,231,615 M59I probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr484 A G 7: 108,124,834 V143A probably benign Het
Olfr807 C A 10: 129,754,563 E296* probably null Het
Olfr839-ps1 T C 9: 19,175,508 H56R probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pcdha11 T A 18: 37,005,851 Y178N probably benign Het
Pcdhga11 C T 18: 37,757,130 T397M possibly damaging Het
Pdlim5 G T 3: 142,259,185 H428N probably damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Rgs3 A G 4: 62,701,112 D478G possibly damaging Het
Scgb2b11 C T 7: 32,210,458 E68K probably damaging Het
Sema4b C A 7: 80,220,247 Q428K probably benign Het
Serpine2 T C 1: 79,802,905 T276A probably benign Het
Sgo2b G A 8: 63,940,074 H110Y probably benign Het
Slc12a7 T C 13: 73,806,089 L833S probably benign Het
Slc6a15 T A 10: 103,393,380 probably null Het
Srfbp1 G A 18: 52,475,599 V24I probably damaging Het
Stpg2 A T 3: 139,701,697 N537Y probably damaging Het
Svep1 A T 4: 58,087,782 S1766T probably benign Het
Tiam2 T A 17: 3,482,605 M1K probably null Het
Tmem245 A T 4: 56,899,170 I661K possibly damaging Het
Trim5 T C 7: 104,279,362 H124R probably damaging Het
Trim67 T A 8: 124,820,285 L478Q probably damaging Het
Triml2 A G 8: 43,193,320 D282G probably damaging Het
Txndc11 T C 16: 11,087,929 Y579C probably damaging Het
Ube3c T A 5: 29,619,631 D551E probably damaging Het
Vmn1r194 T C 13: 22,244,597 V128A not run Het
Vmn2r70 T G 7: 85,568,922 N56T probably damaging Het
Vmn2r-ps130 T A 17: 23,077,032 D725E probably damaging Het
Wdr95 T C 5: 149,594,480 V501A possibly damaging Het
Zc3h8 T C 2: 128,930,822 T249A probably damaging Het
Zfp54 T C 17: 21,434,239 C332R probably damaging Het
Other mutations in Pax8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Pax8 APN 2 24443132 missense probably damaging 1.00
IGL01118:Pax8 APN 2 24442932 splice site probably benign
IGL01141:Pax8 APN 2 24441150 missense probably damaging 1.00
IGL01338:Pax8 APN 2 24435919 missense possibly damaging 0.93
IGL01801:Pax8 APN 2 24444564 critical splice donor site probably null
IGL02159:Pax8 APN 2 24440788 missense possibly damaging 0.56
IGL02727:Pax8 APN 2 24441630 missense probably damaging 0.98
IGL02887:Pax8 APN 2 24444615 missense probably damaging 1.00
IGL03134:Pax8 UTSW 2 24421391 unclassified probably benign
R1499:Pax8 UTSW 2 24429596 missense possibly damaging 0.92
R1756:Pax8 UTSW 2 24435821 missense probably damaging 0.98
R2051:Pax8 UTSW 2 24436508 missense probably benign
R2234:Pax8 UTSW 2 24443102 missense probably damaging 1.00
R2289:Pax8 UTSW 2 24440740 missense probably benign 0.00
R2306:Pax8 UTSW 2 24443045 missense probably damaging 1.00
R4328:Pax8 UTSW 2 24441651 missense possibly damaging 0.92
R4434:Pax8 UTSW 2 24429609 missense possibly damaging 0.93
R4592:Pax8 UTSW 2 24443189 intron probably benign
R4610:Pax8 UTSW 2 24421583 missense probably damaging 0.99
R4873:Pax8 UTSW 2 24441640 missense probably benign 0.04
R4875:Pax8 UTSW 2 24441640 missense probably benign 0.04
R5394:Pax8 UTSW 2 24442910 intron probably benign
R5924:Pax8 UTSW 2 24421622 missense probably damaging 0.97
R6796:Pax8 UTSW 2 24441086 missense probably benign 0.04
R7658:Pax8 UTSW 2 24436511 missense probably benign 0.00
R7690:Pax8 UTSW 2 24441670 missense probably benign 0.37
R7775:Pax8 UTSW 2 24435901 missense possibly damaging 0.93
R7793:Pax8 UTSW 2 24429597 missense possibly damaging 0.85
R7824:Pax8 UTSW 2 24435901 missense possibly damaging 0.93
R7859:Pax8 UTSW 2 24421555 missense possibly damaging 0.93
R8225:Pax8 UTSW 2 24422971 missense probably damaging 0.99
R8520:Pax8 UTSW 2 24443022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAGCAGAGCCTATTTCTCC -3'
(R):5'- AAGTCCTGGGAGAGTTCTGG -3'

Sequencing Primer
(F):5'- AGCAGAGCCTATTTCTCCTTTCCAG -3'
(R):5'- AGAGTTCTGGGGCTCTGAG -3'
Posted On2019-11-12