Incidental Mutation 'R7660:Pax8'
ID 591476
Institutional Source Beutler Lab
Gene Symbol Pax8
Ensembl Gene ENSMUSG00000026976
Gene Name paired box 8
Synonyms Pax-8
MMRRC Submission 045735-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7660 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 24310572-24365611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24326573 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 263 (Y263C)
Ref Sequence ENSEMBL: ENSMUSP00000028355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028355] [ENSMUST00000136228] [ENSMUST00000149294] [ENSMUST00000153535] [ENSMUST00000153601]
AlphaFold Q00288
Predicted Effect probably benign
Transcript: ENSMUST00000028355
AA Change: Y263C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028355
Gene: ENSMUSG00000026976
AA Change: Y263C

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 8e-5 SMART
low complexity region 311 328 N/A INTRINSIC
Pfam:Pax2_C 344 456 2.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136228
AA Change: Y264C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133316
Gene: ENSMUSG00000026976
AA Change: Y264C

DomainStartEndE-ValueType
PAX 9 134 9.13e-91 SMART
SCOP:d1fjla_ 221 248 8e-5 SMART
low complexity region 312 329 N/A INTRINSIC
Pfam:Pax2_C 342 404 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149294
AA Change: Y263C

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115194
Gene: ENSMUSG00000026976
AA Change: Y263C

DomainStartEndE-ValueType
PAX 9 133 3.1e-93 SMART
SCOP:d1ftt__ 221 247 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153535
SMART Domains Protein: ENSMUSP00000120319
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
PAX 9 134 9.13e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153601
SMART Domains Protein: ENSMUSP00000134343
Gene: ENSMUSG00000026976

DomainStartEndE-ValueType
SCOP:d1ftt__ 23 49 1e-4 SMART
Meta Mutation Damage Score 0.2740 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcription factors that contain a characteristic N-terminal paired DNA-binding domain. The encoded protein is important for proper differentiation of the thyroid and the kidney. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit severe hypothyroidism due to thyroid follicular cell aplasia, male infertility, deafness, ataxia, growth retardation, tiny spleens, impaired ossification of long bones and maturation of the small intestine, fatty livers, and lethality around weaning age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,754,512 (GRCm39) H142L possibly damaging Het
Aadacl2fm3 A G 3: 59,772,689 (GRCm39) I64M probably benign Het
Abca13 A G 11: 9,240,678 (GRCm39) E847G probably benign Het
Abca9 T A 11: 110,006,278 (GRCm39) T1276S probably benign Het
Abcb11 C T 2: 69,117,938 (GRCm39) probably null Het
Alpk1 G C 3: 127,474,616 (GRCm39) H462Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atm C T 9: 53,356,807 (GRCm39) V2815M probably benign Het
Braf T C 6: 39,600,575 (GRCm39) I681V possibly damaging Het
Casc3 C G 11: 98,700,699 (GRCm39) R4G unknown Het
Cilk1 G C 9: 78,074,902 (GRCm39) V586L probably benign Het
Crybg1 T C 10: 43,874,831 (GRCm39) D759G probably damaging Het
Csrp2 A G 10: 110,773,624 (GRCm39) N103S probably benign Het
Faf1 A T 4: 109,719,034 (GRCm39) H380L probably damaging Het
Farp1 G A 14: 121,514,334 (GRCm39) A888T probably benign Het
Fat4 A T 3: 39,035,309 (GRCm39) Q2987L probably benign Het
Fkbp15 T A 4: 62,232,578 (GRCm39) T665S probably benign Het
Gigyf1 T C 5: 137,519,231 (GRCm39) S343P probably benign Het
Glrx3 A G 7: 137,060,954 (GRCm39) Y196C probably damaging Het
Gm3278 T G 14: 16,080,387 (GRCm39) L66R probably damaging Het
Ifi205 A G 1: 173,855,814 (GRCm39) V72A probably benign Het
Ift140 T G 17: 25,270,798 (GRCm39) L708R probably damaging Het
Ints13 A T 6: 146,458,836 (GRCm39) L328M probably benign Het
Itfg2 A G 6: 128,401,709 (GRCm39) I23T probably damaging Het
Ldha C T 7: 46,499,681 (GRCm39) P100S unknown Het
Lmtk2 T A 5: 144,085,158 (GRCm39) L210H probably damaging Het
Lrrc4 T A 6: 28,829,816 (GRCm39) I600L probably benign Het
Map2 C A 1: 66,453,536 (GRCm39) P809T probably damaging Het
Matn2 T A 15: 34,423,874 (GRCm39) C577* probably null Het
Matn2 A G 15: 34,403,092 (GRCm39) K439R probably benign Het
Mep1a C T 17: 43,789,868 (GRCm39) G494S probably benign Het
Mtmr4 T C 11: 87,495,406 (GRCm39) F488L probably damaging Het
Mtus1 G T 8: 41,469,248 (GRCm39) T8K probably benign Het
Mug1 C A 6: 121,838,179 (GRCm39) H470N possibly damaging Het
Mybpc1 T C 10: 88,384,716 (GRCm39) T523A possibly damaging Het
Ncoa3 C T 2: 165,911,241 (GRCm39) P1334S probably benign Het
Neb T G 2: 52,139,451 (GRCm39) M119L Het
Nox4 T C 7: 87,019,230 (GRCm39) Y408H probably damaging Het
Nxpe3 C T 16: 55,664,690 (GRCm39) R510Q probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or4f52 C T 2: 111,061,960 (GRCm39) M59I probably damaging Het
Or5p60 A G 7: 107,724,041 (GRCm39) V143A probably benign Het
Or6c214 C A 10: 129,590,432 (GRCm39) E296* probably null Het
Or7g23 T C 9: 19,086,804 (GRCm39) H56R probably benign Het
Or8k31-ps1 A T 2: 86,356,174 (GRCm39) S116T possibly damaging Het
Paip1 C T 13: 119,587,306 (GRCm39) T390I possibly damaging Het
Pcdha11 T A 18: 37,138,904 (GRCm39) Y178N probably benign Het
Pcdhga11 C T 18: 37,890,183 (GRCm39) T397M possibly damaging Het
Pdlim5 G T 3: 141,964,946 (GRCm39) H428N probably damaging Het
Pigg G A 5: 108,486,485 (GRCm39) V713I probably benign Het
Rgs3 A G 4: 62,619,349 (GRCm39) D478G possibly damaging Het
Scgb2b11 C T 7: 31,909,883 (GRCm39) E68K probably damaging Het
Sema4b C A 7: 79,869,995 (GRCm39) Q428K probably benign Het
Semp2l2a A T 8: 13,887,995 (GRCm39) I32K probably benign Het
Serpine2 T C 1: 79,780,622 (GRCm39) T276A probably benign Het
Sgo2b G A 8: 64,393,108 (GRCm39) H110Y probably benign Het
Slc12a7 T C 13: 73,954,208 (GRCm39) L833S probably benign Het
Slc6a15 T A 10: 103,229,241 (GRCm39) probably null Het
Srfbp1 G A 18: 52,608,671 (GRCm39) V24I probably damaging Het
Stpg2 A T 3: 139,407,458 (GRCm39) N537Y probably damaging Het
Svep1 A T 4: 58,087,782 (GRCm39) S1766T probably benign Het
Tiam2 T A 17: 3,532,880 (GRCm39) M1K probably null Het
Tmem245 A T 4: 56,899,170 (GRCm39) I661K possibly damaging Het
Trim5 T C 7: 103,928,569 (GRCm39) H124R probably damaging Het
Trim67 T A 8: 125,547,024 (GRCm39) L478Q probably damaging Het
Triml2 A G 8: 43,646,357 (GRCm39) D282G probably damaging Het
Txndc11 T C 16: 10,905,793 (GRCm39) Y579C probably damaging Het
Ube3c T A 5: 29,824,629 (GRCm39) D551E probably damaging Het
Vmn1r194 T C 13: 22,428,767 (GRCm39) V128A not run Het
Vmn2r130 T A 17: 23,296,006 (GRCm39) D725E probably damaging Het
Vmn2r70 T G 7: 85,218,130 (GRCm39) N56T probably damaging Het
Wdr95 T C 5: 149,517,945 (GRCm39) V501A possibly damaging Het
Zc3h8 T C 2: 128,772,742 (GRCm39) T249A probably damaging Het
Zfp54 T C 17: 21,654,501 (GRCm39) C332R probably damaging Het
Other mutations in Pax8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Pax8 APN 2 24,333,144 (GRCm39) missense probably damaging 1.00
IGL01118:Pax8 APN 2 24,332,944 (GRCm39) splice site probably benign
IGL01141:Pax8 APN 2 24,331,162 (GRCm39) missense probably damaging 1.00
IGL01338:Pax8 APN 2 24,325,931 (GRCm39) missense possibly damaging 0.93
IGL01801:Pax8 APN 2 24,334,576 (GRCm39) critical splice donor site probably null
IGL02159:Pax8 APN 2 24,330,800 (GRCm39) missense possibly damaging 0.56
IGL02727:Pax8 APN 2 24,331,642 (GRCm39) missense probably damaging 0.98
IGL02887:Pax8 APN 2 24,334,627 (GRCm39) missense probably damaging 1.00
IGL03134:Pax8 UTSW 2 24,311,403 (GRCm39) unclassified probably benign
R1499:Pax8 UTSW 2 24,319,608 (GRCm39) missense possibly damaging 0.92
R1756:Pax8 UTSW 2 24,325,833 (GRCm39) missense probably damaging 0.98
R2051:Pax8 UTSW 2 24,326,520 (GRCm39) missense probably benign
R2234:Pax8 UTSW 2 24,333,114 (GRCm39) missense probably damaging 1.00
R2289:Pax8 UTSW 2 24,330,752 (GRCm39) missense probably benign 0.00
R2306:Pax8 UTSW 2 24,333,057 (GRCm39) missense probably damaging 1.00
R4328:Pax8 UTSW 2 24,331,663 (GRCm39) missense possibly damaging 0.92
R4434:Pax8 UTSW 2 24,319,621 (GRCm39) missense possibly damaging 0.93
R4592:Pax8 UTSW 2 24,333,201 (GRCm39) intron probably benign
R4610:Pax8 UTSW 2 24,311,595 (GRCm39) missense probably damaging 0.99
R4873:Pax8 UTSW 2 24,331,652 (GRCm39) missense probably benign 0.04
R4875:Pax8 UTSW 2 24,331,652 (GRCm39) missense probably benign 0.04
R5394:Pax8 UTSW 2 24,332,922 (GRCm39) intron probably benign
R5924:Pax8 UTSW 2 24,311,634 (GRCm39) missense probably damaging 0.97
R6796:Pax8 UTSW 2 24,331,098 (GRCm39) missense probably benign 0.04
R7658:Pax8 UTSW 2 24,326,523 (GRCm39) missense probably benign 0.00
R7690:Pax8 UTSW 2 24,331,682 (GRCm39) missense probably benign 0.37
R7775:Pax8 UTSW 2 24,325,913 (GRCm39) missense possibly damaging 0.93
R7793:Pax8 UTSW 2 24,319,609 (GRCm39) missense possibly damaging 0.85
R7824:Pax8 UTSW 2 24,325,913 (GRCm39) missense possibly damaging 0.93
R7859:Pax8 UTSW 2 24,311,567 (GRCm39) missense possibly damaging 0.93
R8225:Pax8 UTSW 2 24,312,983 (GRCm39) missense probably damaging 0.99
R8520:Pax8 UTSW 2 24,333,034 (GRCm39) missense probably damaging 1.00
R9651:Pax8 UTSW 2 24,331,173 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCAGCAGAGCCTATTTCTCC -3'
(R):5'- AAGTCCTGGGAGAGTTCTGG -3'

Sequencing Primer
(F):5'- AGCAGAGCCTATTTCTCCTTTCCAG -3'
(R):5'- AGAGTTCTGGGGCTCTGAG -3'
Posted On 2019-11-12