Incidental Mutation 'R7660:Ncoa3'
ID 591482
Institutional Source Beutler Lab
Gene Symbol Ncoa3
Ensembl Gene ENSMUSG00000027678
Gene Name nuclear receptor coactivator 3
Synonyms 2010305B15Rik, AIB1, KAT13B, RAC3, TRAM1, TRAM-1, bHLHe42, pCIP, Src3
MMRRC Submission 045735-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.962) question?
Stock # R7660 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 165834557-165915162 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 165911241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 1334 (P1334S)
Ref Sequence ENSEMBL: ENSMUSP00000085416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088086] [ENSMUST00000088095] [ENSMUST00000109249] [ENSMUST00000109252] [ENSMUST00000146497]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000088086
SMART Domains Protein: ENSMUSP00000085405
Gene: ENSMUSG00000006800

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 669 5.6e-47 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088095
AA Change: P1334S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000085416
Gene: ENSMUSG00000027678
AA Change: P1334S

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 1.6e-34 PFAM
Pfam:NCOA_u2 451 564 7.1e-46 PFAM
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 1.6e-32 PFAM
Pfam:DUF4927 714 801 2e-32 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1104 2.1e-27 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1221 1233 N/A INTRINSIC
low complexity region 1243 1263 N/A INTRINSIC
DUF1518 1270 1327 1.08e-21 SMART
low complexity region 1384 1398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109249
SMART Domains Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sulfatase 44 375 2.8e-50 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 532 670 1.3e-46 PFAM
low complexity region 702 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109252
AA Change: P1333S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000104875
Gene: ENSMUSG00000027678
AA Change: P1333S

DomainStartEndE-ValueType
HLH 32 89 5.63e-9 SMART
PAS 113 179 1.16e-11 SMART
Pfam:PAS_11 261 372 4.1e-34 PFAM
low complexity region 438 467 N/A INTRINSIC
low complexity region 502 522 N/A INTRINSIC
low complexity region 527 535 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
Pfam:SRC-1 608 696 3.5e-28 PFAM
coiled coil region 960 997 N/A INTRINSIC
Pfam:Nuc_rec_co-act 1056 1106 6.6e-29 PFAM
low complexity region 1180 1197 N/A INTRINSIC
low complexity region 1218 1232 N/A INTRINSIC
low complexity region 1242 1262 N/A INTRINSIC
DUF1518 1269 1326 1.08e-21 SMART
low complexity region 1383 1397 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146497
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has histone acetyltransferase activity and recruits p300/CBP-associated factor and CREB binding protein as part of a multisubunit coactivation complex. This protein is initially found in the cytoplasm but is translocated into the nucleus upon phosphorylation. Several transcript variants encoding different isoforms have been found for this gene. In addition, a polymorphic repeat region is found in the C-terminus of the encoded protein. [provided by RefSeq, Mar 2010]
PHENOTYPE: Nullizygous mice exhibit growth defects and reduced serum IGF-1 levels and may show impaired proliferative responses to various factors, delayed mammary gland growth and puberty, reproductive dysfunction, susceptibility to endotoxin shock, altered lymphopoiesis, and protection against obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,754,512 (GRCm39) H142L possibly damaging Het
Aadacl2fm3 A G 3: 59,772,689 (GRCm39) I64M probably benign Het
Abca13 A G 11: 9,240,678 (GRCm39) E847G probably benign Het
Abca9 T A 11: 110,006,278 (GRCm39) T1276S probably benign Het
Abcb11 C T 2: 69,117,938 (GRCm39) probably null Het
Alpk1 G C 3: 127,474,616 (GRCm39) H462Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atm C T 9: 53,356,807 (GRCm39) V2815M probably benign Het
Braf T C 6: 39,600,575 (GRCm39) I681V possibly damaging Het
Casc3 C G 11: 98,700,699 (GRCm39) R4G unknown Het
Cilk1 G C 9: 78,074,902 (GRCm39) V586L probably benign Het
Crybg1 T C 10: 43,874,831 (GRCm39) D759G probably damaging Het
Csrp2 A G 10: 110,773,624 (GRCm39) N103S probably benign Het
Faf1 A T 4: 109,719,034 (GRCm39) H380L probably damaging Het
Farp1 G A 14: 121,514,334 (GRCm39) A888T probably benign Het
Fat4 A T 3: 39,035,309 (GRCm39) Q2987L probably benign Het
Fkbp15 T A 4: 62,232,578 (GRCm39) T665S probably benign Het
Gigyf1 T C 5: 137,519,231 (GRCm39) S343P probably benign Het
Glrx3 A G 7: 137,060,954 (GRCm39) Y196C probably damaging Het
Gm3278 T G 14: 16,080,387 (GRCm39) L66R probably damaging Het
Ifi205 A G 1: 173,855,814 (GRCm39) V72A probably benign Het
Ift140 T G 17: 25,270,798 (GRCm39) L708R probably damaging Het
Ints13 A T 6: 146,458,836 (GRCm39) L328M probably benign Het
Itfg2 A G 6: 128,401,709 (GRCm39) I23T probably damaging Het
Ldha C T 7: 46,499,681 (GRCm39) P100S unknown Het
Lmtk2 T A 5: 144,085,158 (GRCm39) L210H probably damaging Het
Lrrc4 T A 6: 28,829,816 (GRCm39) I600L probably benign Het
Map2 C A 1: 66,453,536 (GRCm39) P809T probably damaging Het
Matn2 T A 15: 34,423,874 (GRCm39) C577* probably null Het
Matn2 A G 15: 34,403,092 (GRCm39) K439R probably benign Het
Mep1a C T 17: 43,789,868 (GRCm39) G494S probably benign Het
Mtmr4 T C 11: 87,495,406 (GRCm39) F488L probably damaging Het
Mtus1 G T 8: 41,469,248 (GRCm39) T8K probably benign Het
Mug1 C A 6: 121,838,179 (GRCm39) H470N possibly damaging Het
Mybpc1 T C 10: 88,384,716 (GRCm39) T523A possibly damaging Het
Neb T G 2: 52,139,451 (GRCm39) M119L Het
Nox4 T C 7: 87,019,230 (GRCm39) Y408H probably damaging Het
Nxpe3 C T 16: 55,664,690 (GRCm39) R510Q probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or4f52 C T 2: 111,061,960 (GRCm39) M59I probably damaging Het
Or5p60 A G 7: 107,724,041 (GRCm39) V143A probably benign Het
Or6c214 C A 10: 129,590,432 (GRCm39) E296* probably null Het
Or7g23 T C 9: 19,086,804 (GRCm39) H56R probably benign Het
Or8k31-ps1 A T 2: 86,356,174 (GRCm39) S116T possibly damaging Het
Paip1 C T 13: 119,587,306 (GRCm39) T390I possibly damaging Het
Pax8 T C 2: 24,326,573 (GRCm39) Y263C probably benign Het
Pcdha11 T A 18: 37,138,904 (GRCm39) Y178N probably benign Het
Pcdhga11 C T 18: 37,890,183 (GRCm39) T397M possibly damaging Het
Pdlim5 G T 3: 141,964,946 (GRCm39) H428N probably damaging Het
Pigg G A 5: 108,486,485 (GRCm39) V713I probably benign Het
Rgs3 A G 4: 62,619,349 (GRCm39) D478G possibly damaging Het
Scgb2b11 C T 7: 31,909,883 (GRCm39) E68K probably damaging Het
Sema4b C A 7: 79,869,995 (GRCm39) Q428K probably benign Het
Semp2l2a A T 8: 13,887,995 (GRCm39) I32K probably benign Het
Serpine2 T C 1: 79,780,622 (GRCm39) T276A probably benign Het
Sgo2b G A 8: 64,393,108 (GRCm39) H110Y probably benign Het
Slc12a7 T C 13: 73,954,208 (GRCm39) L833S probably benign Het
Slc6a15 T A 10: 103,229,241 (GRCm39) probably null Het
Srfbp1 G A 18: 52,608,671 (GRCm39) V24I probably damaging Het
Stpg2 A T 3: 139,407,458 (GRCm39) N537Y probably damaging Het
Svep1 A T 4: 58,087,782 (GRCm39) S1766T probably benign Het
Tiam2 T A 17: 3,532,880 (GRCm39) M1K probably null Het
Tmem245 A T 4: 56,899,170 (GRCm39) I661K possibly damaging Het
Trim5 T C 7: 103,928,569 (GRCm39) H124R probably damaging Het
Trim67 T A 8: 125,547,024 (GRCm39) L478Q probably damaging Het
Triml2 A G 8: 43,646,357 (GRCm39) D282G probably damaging Het
Txndc11 T C 16: 10,905,793 (GRCm39) Y579C probably damaging Het
Ube3c T A 5: 29,824,629 (GRCm39) D551E probably damaging Het
Vmn1r194 T C 13: 22,428,767 (GRCm39) V128A not run Het
Vmn2r130 T A 17: 23,296,006 (GRCm39) D725E probably damaging Het
Vmn2r70 T G 7: 85,218,130 (GRCm39) N56T probably damaging Het
Wdr95 T C 5: 149,517,945 (GRCm39) V501A possibly damaging Het
Zc3h8 T C 2: 128,772,742 (GRCm39) T249A probably damaging Het
Zfp54 T C 17: 21,654,501 (GRCm39) C332R probably damaging Het
Other mutations in Ncoa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Ncoa3 APN 2 165,893,529 (GRCm39) splice site probably null
IGL01068:Ncoa3 APN 2 165,894,715 (GRCm39) missense probably damaging 1.00
IGL01300:Ncoa3 APN 2 165,910,381 (GRCm39) missense probably benign 0.41
IGL01336:Ncoa3 APN 2 165,896,443 (GRCm39) missense probably benign
IGL01533:Ncoa3 APN 2 165,896,945 (GRCm39) missense probably benign 0.03
IGL01658:Ncoa3 APN 2 165,893,222 (GRCm39) splice site probably benign
IGL02053:Ncoa3 APN 2 165,896,754 (GRCm39) missense probably damaging 1.00
IGL02138:Ncoa3 APN 2 165,897,182 (GRCm39) missense probably benign
IGL02167:Ncoa3 APN 2 165,912,056 (GRCm39) missense probably damaging 1.00
IGL02217:Ncoa3 APN 2 165,897,266 (GRCm39) missense probably damaging 1.00
IGL02312:Ncoa3 APN 2 165,899,120 (GRCm39) missense probably benign 0.10
IGL02381:Ncoa3 APN 2 165,894,737 (GRCm39) missense probably damaging 1.00
IGL02568:Ncoa3 APN 2 165,911,277 (GRCm39) missense probably damaging 1.00
IGL02658:Ncoa3 APN 2 165,893,313 (GRCm39) missense probably benign 0.01
IGL02806:Ncoa3 APN 2 165,894,352 (GRCm39) missense probably benign 0.25
R0054:Ncoa3 UTSW 2 165,897,098 (GRCm39) missense possibly damaging 0.67
R0054:Ncoa3 UTSW 2 165,897,098 (GRCm39) missense possibly damaging 0.67
R0240:Ncoa3 UTSW 2 165,896,320 (GRCm39) missense probably benign
R0240:Ncoa3 UTSW 2 165,896,320 (GRCm39) missense probably benign
R0333:Ncoa3 UTSW 2 165,896,211 (GRCm39) missense probably damaging 1.00
R0379:Ncoa3 UTSW 2 165,896,422 (GRCm39) missense probably damaging 0.97
R0411:Ncoa3 UTSW 2 165,910,463 (GRCm39) missense probably benign 0.31
R0734:Ncoa3 UTSW 2 165,911,111 (GRCm39) unclassified probably benign
R1434:Ncoa3 UTSW 2 165,897,430 (GRCm39) missense probably benign 0.01
R1491:Ncoa3 UTSW 2 165,897,182 (GRCm39) missense probably benign
R1721:Ncoa3 UTSW 2 165,911,221 (GRCm39) missense possibly damaging 0.55
R1895:Ncoa3 UTSW 2 165,901,097 (GRCm39) missense possibly damaging 0.68
R1896:Ncoa3 UTSW 2 165,890,384 (GRCm39) missense probably benign 0.36
R1946:Ncoa3 UTSW 2 165,901,097 (GRCm39) missense possibly damaging 0.68
R2406:Ncoa3 UTSW 2 165,897,279 (GRCm39) missense probably damaging 1.00
R3800:Ncoa3 UTSW 2 165,901,639 (GRCm39) missense possibly damaging 0.58
R3825:Ncoa3 UTSW 2 165,896,718 (GRCm39) missense possibly damaging 0.83
R4377:Ncoa3 UTSW 2 165,896,417 (GRCm39) missense possibly damaging 0.50
R4674:Ncoa3 UTSW 2 165,901,731 (GRCm39) missense probably benign
R4706:Ncoa3 UTSW 2 165,889,799 (GRCm39) missense probably damaging 1.00
R4751:Ncoa3 UTSW 2 165,911,823 (GRCm39) missense possibly damaging 0.81
R4954:Ncoa3 UTSW 2 165,907,706 (GRCm39) missense probably benign
R4976:Ncoa3 UTSW 2 165,889,820 (GRCm39) missense probably damaging 1.00
R4992:Ncoa3 UTSW 2 165,911,859 (GRCm39) missense probably benign 0.39
R5100:Ncoa3 UTSW 2 165,892,017 (GRCm39) missense probably damaging 1.00
R5578:Ncoa3 UTSW 2 165,896,248 (GRCm39) missense probably benign 0.00
R5932:Ncoa3 UTSW 2 165,912,045 (GRCm39) splice site probably null
R6051:Ncoa3 UTSW 2 165,900,685 (GRCm39) missense probably damaging 1.00
R6370:Ncoa3 UTSW 2 165,907,825 (GRCm39) missense probably benign 0.00
R6372:Ncoa3 UTSW 2 165,901,267 (GRCm39) missense possibly damaging 0.94
R6373:Ncoa3 UTSW 2 165,901,267 (GRCm39) missense possibly damaging 0.94
R7438:Ncoa3 UTSW 2 165,910,449 (GRCm39) missense probably damaging 1.00
R7738:Ncoa3 UTSW 2 165,891,987 (GRCm39) missense probably damaging 1.00
R7752:Ncoa3 UTSW 2 165,907,688 (GRCm39) nonsense probably null
R7970:Ncoa3 UTSW 2 165,893,277 (GRCm39) missense probably benign 0.01
R8829:Ncoa3 UTSW 2 165,892,068 (GRCm39) missense probably damaging 1.00
R9133:Ncoa3 UTSW 2 165,910,381 (GRCm39) missense possibly damaging 0.92
R9625:Ncoa3 UTSW 2 165,899,130 (GRCm39) missense probably benign
X0018:Ncoa3 UTSW 2 165,896,722 (GRCm39) missense possibly damaging 0.58
Z1177:Ncoa3 UTSW 2 165,890,428 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAGTCCATGGATGCTGC -3'
(R):5'- AAAAGCTTCTGGACAGCCTG -3'

Sequencing Primer
(F):5'- CCATGGATGCTGCATTTGAACAC -3'
(R):5'- TGCGCTCACAGACATGG -3'
Posted On 2019-11-12