Mutagenetix > Incidental Mutation

Incidental Mutation 'R7660:Ncoa3'

591482

Institutional Source

Beutler Lab

Gene Symbol

Ncoa3

Ensembl Gene

ENSMUSG00000027678

Gene Name

nuclear receptor coactivator 3

Synonyms

TRAM-1, RAC3, AIB1, Src3, KAT13B, TRAM1, pCIP, bHLHe42, 2010305B15Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R7660 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

165992636-166073242 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 166069321 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1334 (P1334S)

Ref Sequence

ENSEMBL: ENSMUSP00000085416 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088086] [ENSMUST00000088095] [ENSMUST00000109249] [ENSMUST00000109252] [ENSMUST00000146497]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000088086

SMART Domains

Protein: ENSMUSP00000085405
Gene: ENSMUSG00000006800

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Sulfatase	44	375	2.8e-50	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	533	669	5.6e-47	PFAM
low complexity region	702	720	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000088095
AA Change: P1334S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000085416
Gene: ENSMUSG00000027678
AA Change: P1334S

Domain	Start	End	E-Value	Type
HLH	32	89	5.63e-9	SMART
PAS	113	179	1.16e-11	SMART
Pfam:PAS_11	261	372	1.6e-34	PFAM
Pfam:NCOA_u2	451	564	7.1e-46	PFAM
low complexity region	586	599	N/A	INTRINSIC
Pfam:SRC-1	608	696	1.6e-32	PFAM
Pfam:DUF4927	714	801	2e-32	PFAM
coiled coil region	960	997	N/A	INTRINSIC
Pfam:Nuc_rec_co-act	1056	1104	2.1e-27	PFAM
low complexity region	1180	1197	N/A	INTRINSIC
low complexity region	1221	1233	N/A	INTRINSIC
low complexity region	1243	1263	N/A	INTRINSIC
DUF1518	1270	1327	1.08e-21	SMART
low complexity region	1384	1398	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109249

SMART Domains

Protein: ENSMUSP00000104872
Gene: ENSMUSG00000006800

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Sulfatase	44	375	2.8e-50	PFAM
low complexity region	512	523	N/A	INTRINSIC
Pfam:DUF3740	532	670	1.3e-46	PFAM
low complexity region	702	720	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109252
AA Change: P1333S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000104875
Gene: ENSMUSG00000027678
AA Change: P1333S

Domain	Start	End	E-Value	Type
HLH	32	89	5.63e-9	SMART
PAS	113	179	1.16e-11	SMART
Pfam:PAS_11	261	372	4.1e-34	PFAM
low complexity region	438	467	N/A	INTRINSIC
low complexity region	502	522	N/A	INTRINSIC
low complexity region	527	535	N/A	INTRINSIC
low complexity region	586	599	N/A	INTRINSIC
Pfam:SRC-1	608	696	3.5e-28	PFAM
coiled coil region	960	997	N/A	INTRINSIC
Pfam:Nuc_rec_co-act	1056	1106	6.6e-29	PFAM
low complexity region	1180	1197	N/A	INTRINSIC
low complexity region	1218	1232	N/A	INTRINSIC
low complexity region	1242	1262	N/A	INTRINSIC
DUF1518	1269	1326	1.08e-21	SMART
low complexity region	1383	1397	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146497

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.3%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear receptor coactivator that interacts with nuclear hormone receptors to enhance their transcriptional activator functions. The encoded protein has histone acetyltransferase activity and recruits p300/CBP-associated factor and CREB binding protein as part of a multisubunit coactivation complex. This protein is initially found in the cytoplasm but is translocated into the nucleus upon phosphorylation. Several transcript variants encoding different isoforms have been found for this gene. In addition, a polymorphic repeat region is found in the C-terminus of the encoded protein. [provided by RefSeq, Mar 2010]
PHENOTYPE: Nullizygous mice exhibit growth defects and reduced serum IGF-1 levels and may show impaired proliferative responses to various factors, delayed mammary gland growth and puberty, reproductive dysfunction, susceptibility to endotoxin shock, altered lymphopoiesis, and protection against obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427I04Rik	A	T	4: 123,860,719	H142L	possibly damaging	Het
Abca13	A	G	11: 9,290,678	E847G	probably benign	Het
Abca9	T	A	11: 110,115,452	T1276S	probably benign	Het
Abcb11	C	T	2: 69,287,594		probably null	Het
AF366264	A	T	8: 13,837,995	I32K	probably benign	Het
Alpk1	G	C	3: 127,680,967	H462Q	probably damaging	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atm	C	T	9: 53,445,507	V2815M	probably benign	Het
Braf	T	C	6: 39,623,641	I681V	possibly damaging	Het
Casc3	C	G	11: 98,809,873	R4G	unknown	Het
Crybg1	T	C	10: 43,998,835	D759G	probably damaging	Het
Csrp2	A	G	10: 110,937,763	N103S	probably benign	Het
Faf1	A	T	4: 109,861,837	H380L	probably damaging	Het
Farp1	G	A	14: 121,276,922	A888T	probably benign	Het
Fat4	A	T	3: 38,981,160	Q2987L	probably benign	Het
Fkbp15	T	A	4: 62,314,341	T665S	probably benign	Het
Gigyf1	T	C	5: 137,520,969	S343P	probably benign	Het
Glrx3	A	G	7: 137,459,225	Y196C	probably damaging	Het
Gm3278	T	G	14: 4,893,349	L66R	probably damaging	Het
Gm8298	A	G	3: 59,865,268	I64M	probably benign	Het
Ick	G	C	9: 78,167,620	V586L	probably benign	Het
Ifi205	A	G	1: 174,028,248	V72A	probably benign	Het
Ift140	T	G	17: 25,051,824	L708R	probably damaging	Het
Ints13	A	T	6: 146,557,338	L328M	probably benign	Het
Itfg2	A	G	6: 128,424,746	I23T	probably damaging	Het
Ldha	C	T	7: 46,850,257	P100S	unknown	Het
Lmtk2	T	A	5: 144,148,340	L210H	probably damaging	Het
Lrrc4	T	A	6: 28,829,817	I600L	probably benign	Het
Map2	C	A	1: 66,414,377	P809T	probably damaging	Het
Matn2	A	G	15: 34,402,946	K439R	probably benign	Het
Matn2	T	A	15: 34,423,728	C577*	probably null	Het
Mep1a	C	T	17: 43,478,977	G494S	probably benign	Het
Mtmr4	T	C	11: 87,604,580	F488L	probably damaging	Het
Mtus1	G	T	8: 41,016,211	T8K	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Mybpc1	T	C	10: 88,548,854	T523A	possibly damaging	Het
Neb	T	G	2: 52,249,439	M119L		Het
Nox4	T	C	7: 87,370,022	Y408H	probably damaging	Het
Nxpe3	C	T	16: 55,844,327	R510Q	probably damaging	Het
Olfr1077-ps1	A	T	2: 86,525,830	S116T	possibly damaging	Het
Olfr1275	C	T	2: 111,231,615	M59I	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr484	A	G	7: 108,124,834	V143A	probably benign	Het
Olfr807	C	A	10: 129,754,563	E296*	probably null	Het
Olfr839-ps1	T	C	9: 19,175,508	H56R	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pax8	T	C	2: 24,436,561	Y263C	probably benign	Het
Pcdha11	T	A	18: 37,005,851	Y178N	probably benign	Het
Pcdhga11	C	T	18: 37,757,130	T397M	possibly damaging	Het
Pdlim5	G	T	3: 142,259,185	H428N	probably damaging	Het
Pigg	G	A	5: 108,338,619	V713I	probably benign	Het
Rgs3	A	G	4: 62,701,112	D478G	possibly damaging	Het
Scgb2b11	C	T	7: 32,210,458	E68K	probably damaging	Het
Sema4b	C	A	7: 80,220,247	Q428K	probably benign	Het
Serpine2	T	C	1: 79,802,905	T276A	probably benign	Het
Sgo2b	G	A	8: 63,940,074	H110Y	probably benign	Het
Slc12a7	T	C	13: 73,806,089	L833S	probably benign	Het
Slc6a15	T	A	10: 103,393,380		probably null	Het
Srfbp1	G	A	18: 52,475,599	V24I	probably damaging	Het
Stpg2	A	T	3: 139,701,697	N537Y	probably damaging	Het
Svep1	A	T	4: 58,087,782	S1766T	probably benign	Het
Tiam2	T	A	17: 3,482,605	M1K	probably null	Het
Tmem245	A	T	4: 56,899,170	I661K	possibly damaging	Het
Trim5	T	C	7: 104,279,362	H124R	probably damaging	Het
Trim67	T	A	8: 124,820,285	L478Q	probably damaging	Het
Triml2	A	G	8: 43,193,320	D282G	probably damaging	Het
Txndc11	T	C	16: 11,087,929	Y579C	probably damaging	Het
Ube3c	T	A	5: 29,619,631	D551E	probably damaging	Het
Vmn1r194	T	C	13: 22,244,597	V128A	not run	Het
Vmn2r70	T	G	7: 85,568,922	N56T	probably damaging	Het
Vmn2r-ps130	T	A	17: 23,077,032	D725E	probably damaging	Het
Wdr95	T	C	5: 149,594,480	V501A	possibly damaging	Het
Zc3h8	T	C	2: 128,930,822	T249A	probably damaging	Het
Zfp54	T	C	17: 21,434,239	C332R	probably damaging	Het

Other mutations in Ncoa3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00929:Ncoa3	APN	2	166051609	splice site	probably null
IGL01068:Ncoa3	APN	2	166052795	missense	probably damaging	1.00
IGL01300:Ncoa3	APN	2	166068461	missense	probably benign	0.41
IGL01336:Ncoa3	APN	2	166054523	missense	probably benign
IGL01533:Ncoa3	APN	2	166055025	missense	probably benign	0.03
IGL01658:Ncoa3	APN	2	166051302	splice site	probably benign
IGL02053:Ncoa3	APN	2	166054834	missense	probably damaging	1.00
IGL02138:Ncoa3	APN	2	166055262	missense	probably benign
IGL02167:Ncoa3	APN	2	166070136	missense	probably damaging	1.00
IGL02217:Ncoa3	APN	2	166055346	missense	probably damaging	1.00
IGL02312:Ncoa3	APN	2	166057200	missense	probably benign	0.10
IGL02381:Ncoa3	APN	2	166052817	missense	probably damaging	1.00
IGL02568:Ncoa3	APN	2	166069357	missense	probably damaging	1.00
IGL02658:Ncoa3	APN	2	166051393	missense	probably benign	0.01
IGL02806:Ncoa3	APN	2	166052432	missense	probably benign	0.25
R0054:Ncoa3	UTSW	2	166055178	missense	possibly damaging	0.67
R0054:Ncoa3	UTSW	2	166055178	missense	possibly damaging	0.67
R0240:Ncoa3	UTSW	2	166054400	missense	probably benign
R0240:Ncoa3	UTSW	2	166054400	missense	probably benign
R0333:Ncoa3	UTSW	2	166054291	missense	probably damaging	1.00
R0379:Ncoa3	UTSW	2	166054502	missense	probably damaging	0.97
R0411:Ncoa3	UTSW	2	166068543	missense	probably benign	0.31
R0734:Ncoa3	UTSW	2	166069191	unclassified	probably benign
R1434:Ncoa3	UTSW	2	166055510	missense	probably benign	0.01
R1491:Ncoa3	UTSW	2	166055262	missense	probably benign
R1721:Ncoa3	UTSW	2	166069301	missense	possibly damaging	0.55
R1895:Ncoa3	UTSW	2	166059177	missense	possibly damaging	0.68
R1896:Ncoa3	UTSW	2	166048464	missense	probably benign	0.36
R1946:Ncoa3	UTSW	2	166059177	missense	possibly damaging	0.68
R2406:Ncoa3	UTSW	2	166055359	missense	probably damaging	1.00
R3800:Ncoa3	UTSW	2	166059719	missense	possibly damaging	0.58
R3825:Ncoa3	UTSW	2	166054798	missense	possibly damaging	0.83
R4377:Ncoa3	UTSW	2	166054497	missense	possibly damaging	0.50
R4674:Ncoa3	UTSW	2	166059811	missense	probably benign
R4706:Ncoa3	UTSW	2	166047879	missense	probably damaging	1.00
R4751:Ncoa3	UTSW	2	166069903	missense	possibly damaging	0.81
R4954:Ncoa3	UTSW	2	166065786	missense	probably benign
R4976:Ncoa3	UTSW	2	166047900	missense	probably damaging	1.00
R4992:Ncoa3	UTSW	2	166069939	missense	probably benign	0.39
R5100:Ncoa3	UTSW	2	166050097	missense	probably damaging	1.00
R5578:Ncoa3	UTSW	2	166054328	missense	probably benign	0.00
R5932:Ncoa3	UTSW	2	166070125	splice site	probably null
R6051:Ncoa3	UTSW	2	166058765	missense	probably damaging	1.00
R6370:Ncoa3	UTSW	2	166065905	missense	probably benign	0.00
R6372:Ncoa3	UTSW	2	166059347	missense	possibly damaging	0.94
R6373:Ncoa3	UTSW	2	166059347	missense	possibly damaging	0.94
R7438:Ncoa3	UTSW	2	166068529	missense	probably damaging	1.00
R7738:Ncoa3	UTSW	2	166050067	missense	probably damaging	1.00
R7752:Ncoa3	UTSW	2	166065768	nonsense	probably null
R7970:Ncoa3	UTSW	2	166051357	missense	probably benign	0.01
R8829:Ncoa3	UTSW	2	166050148	missense	probably damaging	1.00
R9133:Ncoa3	UTSW	2	166068461	missense	possibly damaging	0.92
R9625:Ncoa3	UTSW	2	166057210	missense	probably benign
X0018:Ncoa3	UTSW	2	166054802	missense	possibly damaging	0.58
Z1177:Ncoa3	UTSW	2	166048508	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAAGTCCATGGATGCTGC -3'
(R):5'- AAAAGCTTCTGGACAGCCTG -3'

Sequencing Primer
(F):5'- CCATGGATGCTGCATTTGAACAC -3'
(R):5'- TGCGCTCACAGACATGG -3'

Posted On

2019-11-12