Incidental Mutation 'R7660:Gm8298'
ID591484
Institutional Source Beutler Lab
Gene Symbol Gm8298
Ensembl Gene ENSMUSG00000095522
Gene Namepredicted gene 8298
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7660 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location59861051-59877313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59865268 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 64 (I64M)
Ref Sequence ENSEMBL: ENSMUSP00000137307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179799]
Predicted Effect probably benign
Transcript: ENSMUST00000179799
AA Change: I64M

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000137307
Gene: ENSMUSG00000095522
AA Change: I64M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:COesterase 91 217 9.6e-7 PFAM
Pfam:Abhydrolase_3 107 279 1.1e-36 PFAM
Pfam:Abhydrolase_3 284 375 1.2e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,860,719 H142L possibly damaging Het
Abca13 A G 11: 9,290,678 E847G probably benign Het
Abca9 T A 11: 110,115,452 T1276S probably benign Het
Abcb11 C T 2: 69,287,594 probably null Het
AF366264 A T 8: 13,837,995 I32K probably benign Het
Alpk1 G C 3: 127,680,967 H462Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atm C T 9: 53,445,507 V2815M probably benign Het
Braf T C 6: 39,623,641 I681V possibly damaging Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Crybg1 T C 10: 43,998,835 D759G probably damaging Het
Csrp2 A G 10: 110,937,763 N103S probably benign Het
Faf1 A T 4: 109,861,837 H380L probably damaging Het
Farp1 G A 14: 121,276,922 A888T probably benign Het
Fat4 A T 3: 38,981,160 Q2987L probably benign Het
Fkbp15 T A 4: 62,314,341 T665S probably benign Het
Gigyf1 T C 5: 137,520,969 S343P probably benign Het
Glrx3 A G 7: 137,459,225 Y196C probably damaging Het
Gm3278 T G 14: 4,893,349 L66R probably damaging Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 A G 1: 174,028,248 V72A probably benign Het
Ift140 T G 17: 25,051,824 L708R probably damaging Het
Ints13 A T 6: 146,557,338 L328M probably benign Het
Itfg2 A G 6: 128,424,746 I23T probably damaging Het
Ldha C T 7: 46,850,257 P100S unknown Het
Lmtk2 T A 5: 144,148,340 L210H probably damaging Het
Lrrc4 T A 6: 28,829,817 I600L probably benign Het
Map2 C A 1: 66,414,377 P809T probably damaging Het
Matn2 A G 15: 34,402,946 K439R probably benign Het
Matn2 T A 15: 34,423,728 C577* probably null Het
Mep1a C T 17: 43,478,977 G494S probably benign Het
Mtmr4 T C 11: 87,604,580 F488L probably damaging Het
Mtus1 G T 8: 41,016,211 T8K probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mybpc1 T C 10: 88,548,854 T523A possibly damaging Het
Ncoa3 C T 2: 166,069,321 P1334S probably benign Het
Neb T G 2: 52,249,439 M119L Het
Nox4 T C 7: 87,370,022 Y408H probably damaging Het
Nxpe3 C T 16: 55,844,327 R510Q probably damaging Het
Olfr1077-ps1 A T 2: 86,525,830 S116T possibly damaging Het
Olfr1275 C T 2: 111,231,615 M59I probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr484 A G 7: 108,124,834 V143A probably benign Het
Olfr807 C A 10: 129,754,563 E296* probably null Het
Olfr839-ps1 T C 9: 19,175,508 H56R probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pax8 T C 2: 24,436,561 Y263C probably benign Het
Pcdha11 T A 18: 37,005,851 Y178N probably benign Het
Pcdhga11 C T 18: 37,757,130 T397M possibly damaging Het
Pdlim5 G T 3: 142,259,185 H428N probably damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Rgs3 A G 4: 62,701,112 D478G possibly damaging Het
Scgb2b11 C T 7: 32,210,458 E68K probably damaging Het
Sema4b C A 7: 80,220,247 Q428K probably benign Het
Serpine2 T C 1: 79,802,905 T276A probably benign Het
Sgo2b G A 8: 63,940,074 H110Y probably benign Het
Slc12a7 T C 13: 73,806,089 L833S probably benign Het
Slc6a15 T A 10: 103,393,380 probably null Het
Srfbp1 G A 18: 52,475,599 V24I probably damaging Het
Stpg2 A T 3: 139,701,697 N537Y probably damaging Het
Svep1 A T 4: 58,087,782 S1766T probably benign Het
Tiam2 T A 17: 3,482,605 M1K probably null Het
Tmem245 A T 4: 56,899,170 I661K possibly damaging Het
Trim5 T C 7: 104,279,362 H124R probably damaging Het
Trim67 T A 8: 124,820,285 L478Q probably damaging Het
Triml2 A G 8: 43,193,320 D282G probably damaging Het
Txndc11 T C 16: 11,087,929 Y579C probably damaging Het
Ube3c T A 5: 29,619,631 D551E probably damaging Het
Vmn1r194 T C 13: 22,244,597 V128A not run Het
Vmn2r70 T G 7: 85,568,922 N56T probably damaging Het
Vmn2r-ps130 T A 17: 23,077,032 D725E probably damaging Het
Wdr95 T C 5: 149,594,480 V501A possibly damaging Het
Zc3h8 T C 2: 128,930,822 T249A probably damaging Het
Zfp54 T C 17: 21,434,239 C332R probably damaging Het
Other mutations in Gm8298
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Gm8298 APN 3 59868900 missense possibly damaging 0.80
IGL02064:Gm8298 APN 3 59877042 missense probably damaging 1.00
IGL02317:Gm8298 APN 3 59876987 missense probably benign 0.00
R0270:Gm8298 UTSW 3 59877019 missense probably benign
R0580:Gm8298 UTSW 3 59877049 missense probably damaging 1.00
R1124:Gm8298 UTSW 3 59865218 missense probably benign 0.39
R1208:Gm8298 UTSW 3 59865294 missense probably benign 0.27
R1222:Gm8298 UTSW 3 59877261 nonsense probably null
R1436:Gm8298 UTSW 3 59865339 missense probably damaging 0.98
R1529:Gm8298 UTSW 3 59861112 missense probably benign
R1806:Gm8298 UTSW 3 59877150 missense probably damaging 1.00
R2130:Gm8298 UTSW 3 59865348 missense probably damaging 1.00
R4209:Gm8298 UTSW 3 59877156 missense probably damaging 1.00
R4597:Gm8298 UTSW 3 59876793 missense possibly damaging 0.47
R4910:Gm8298 UTSW 3 59869014 critical splice donor site probably null
R5571:Gm8298 UTSW 3 59877219 missense probably damaging 1.00
R6131:Gm8298 UTSW 3 59868903 missense possibly damaging 0.76
R6447:Gm8298 UTSW 3 59865398 missense probably damaging 0.99
R6481:Gm8298 UTSW 3 59861057 missense probably benign 0.00
R6795:Gm8298 UTSW 3 59868936 missense probably damaging 1.00
R7092:Gm8298 UTSW 3 59861079 missense probably benign 0.41
R7334:Gm8298 UTSW 3 59868959 missense probably damaging 1.00
R7602:Gm8298 UTSW 3 59877276 missense probably benign 0.17
R7705:Gm8298 UTSW 3 59876747 missense probably benign 0.25
R7708:Gm8298 UTSW 3 59865335 missense probably benign 0.00
X0011:Gm8298 UTSW 3 59861177 missense probably benign
X0022:Gm8298 UTSW 3 59877024 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGGGCTTTGCTATATACACTACC -3'
(R):5'- ACTTACTGAAGCTTCCCAAGAT -3'

Sequencing Primer
(F):5'- CGGTAACTCTGGTAACTCAGACTG -3'
(R):5'- TACTGAAGCTTCCCAAGATATAGGCG -3'
Posted On2019-11-12