Incidental Mutation 'R7660:Fkbp15'
ID591490
Institutional Source Beutler Lab
Gene Symbol Fkbp15
Ensembl Gene ENSMUSG00000066151
Gene NameFK506 binding protein 15
SynonymsFKBP133, C430014M02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7660 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location62300342-62360548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62314341 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 665 (T665S)
Ref Sequence ENSEMBL: ENSMUSP00000081575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084527] [ENSMUST00000084528] [ENSMUST00000098033]
Predicted Effect probably benign
Transcript: ENSMUST00000084527
AA Change: T665S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000081575
Gene: ENSMUSG00000066151
AA Change: T665S

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 4.8e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.88e-10 PROSPERO
internal_repeat_1 472 500 1.88e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 790 N/A INTRINSIC
coiled coil region 816 865 N/A INTRINSIC
coiled coil region 916 943 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 983 994 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084528
AA Change: T665S

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000081576
Gene: ENSMUSG00000066151
AA Change: T665S

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2.4e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 2.74e-10 PROSPERO
internal_repeat_1 472 500 2.74e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098033
SMART Domains Protein: ENSMUSP00000095641
Gene: ENSMUSG00000066151

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 1.9e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.79e-8 PROSPERO
internal_repeat_1 472 500 1.79e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,860,719 H142L possibly damaging Het
Abca13 A G 11: 9,290,678 E847G probably benign Het
Abca9 T A 11: 110,115,452 T1276S probably benign Het
Abcb11 C T 2: 69,287,594 probably null Het
AF366264 A T 8: 13,837,995 I32K probably benign Het
Alpk1 G C 3: 127,680,967 H462Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atm C T 9: 53,445,507 V2815M probably benign Het
Braf T C 6: 39,623,641 I681V possibly damaging Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Crybg1 T C 10: 43,998,835 D759G probably damaging Het
Csrp2 A G 10: 110,937,763 N103S probably benign Het
Faf1 A T 4: 109,861,837 H380L probably damaging Het
Farp1 G A 14: 121,276,922 A888T probably benign Het
Fat4 A T 3: 38,981,160 Q2987L probably benign Het
Gigyf1 T C 5: 137,520,969 S343P probably benign Het
Glrx3 A G 7: 137,459,225 Y196C probably damaging Het
Gm3278 T G 14: 4,893,349 L66R probably damaging Het
Gm8298 A G 3: 59,865,268 I64M probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 A G 1: 174,028,248 V72A probably benign Het
Ift140 T G 17: 25,051,824 L708R probably damaging Het
Ints13 A T 6: 146,557,338 L328M probably benign Het
Itfg2 A G 6: 128,424,746 I23T probably damaging Het
Ldha C T 7: 46,850,257 P100S unknown Het
Lmtk2 T A 5: 144,148,340 L210H probably damaging Het
Lrrc4 T A 6: 28,829,817 I600L probably benign Het
Map2 C A 1: 66,414,377 P809T probably damaging Het
Matn2 T A 15: 34,423,728 C577* probably null Het
Matn2 A G 15: 34,402,946 K439R probably benign Het
Mep1a C T 17: 43,478,977 G494S probably benign Het
Mtmr4 T C 11: 87,604,580 F488L probably damaging Het
Mtus1 G T 8: 41,016,211 T8K probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mybpc1 T C 10: 88,548,854 T523A possibly damaging Het
Ncoa3 C T 2: 166,069,321 P1334S probably benign Het
Neb T G 2: 52,249,439 M119L Het
Nox4 T C 7: 87,370,022 Y408H probably damaging Het
Nxpe3 C T 16: 55,844,327 R510Q probably damaging Het
Olfr1077-ps1 A T 2: 86,525,830 S116T possibly damaging Het
Olfr1275 C T 2: 111,231,615 M59I probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr484 A G 7: 108,124,834 V143A probably benign Het
Olfr807 C A 10: 129,754,563 E296* probably null Het
Olfr839-ps1 T C 9: 19,175,508 H56R probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pax8 T C 2: 24,436,561 Y263C probably benign Het
Pcdha11 T A 18: 37,005,851 Y178N probably benign Het
Pcdhga11 C T 18: 37,757,130 T397M possibly damaging Het
Pdlim5 G T 3: 142,259,185 H428N probably damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Rgs3 A G 4: 62,701,112 D478G possibly damaging Het
Scgb2b11 C T 7: 32,210,458 E68K probably damaging Het
Sema4b C A 7: 80,220,247 Q428K probably benign Het
Serpine2 T C 1: 79,802,905 T276A probably benign Het
Sgo2b G A 8: 63,940,074 H110Y probably benign Het
Slc12a7 T C 13: 73,806,089 L833S probably benign Het
Slc6a15 T A 10: 103,393,380 probably null Het
Srfbp1 G A 18: 52,475,599 V24I probably damaging Het
Stpg2 A T 3: 139,701,697 N537Y probably damaging Het
Svep1 A T 4: 58,087,782 S1766T probably benign Het
Tiam2 T A 17: 3,482,605 M1K probably null Het
Tmem245 A T 4: 56,899,170 I661K possibly damaging Het
Trim5 T C 7: 104,279,362 H124R probably damaging Het
Trim67 T A 8: 124,820,285 L478Q probably damaging Het
Triml2 A G 8: 43,193,320 D282G probably damaging Het
Txndc11 T C 16: 11,087,929 Y579C probably damaging Het
Ube3c T A 5: 29,619,631 D551E probably damaging Het
Vmn1r194 T C 13: 22,244,597 V128A not run Het
Vmn2r70 T G 7: 85,568,922 N56T probably damaging Het
Vmn2r-ps130 T A 17: 23,077,032 D725E probably damaging Het
Wdr95 T C 5: 149,594,480 V501A possibly damaging Het
Zc3h8 T C 2: 128,930,822 T249A probably damaging Het
Zfp54 T C 17: 21,434,239 C332R probably damaging Het
Other mutations in Fkbp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Fkbp15 APN 4 62333680 splice site probably benign
IGL01326:Fkbp15 APN 4 62323250 missense probably damaging 0.98
IGL01822:Fkbp15 APN 4 62352504 missense probably benign
IGL01925:Fkbp15 APN 4 62323213 missense probably damaging 1.00
IGL02190:Fkbp15 APN 4 62304822 missense possibly damaging 0.69
IGL02276:Fkbp15 APN 4 62336466 nonsense probably null
IGL02310:Fkbp15 APN 4 62340316 missense probably damaging 1.00
IGL02954:Fkbp15 APN 4 62321065 splice site probably benign
IGL02967:Fkbp15 APN 4 62304390 missense probably damaging 0.96
IGL03136:Fkbp15 APN 4 62340229 splice site probably benign
IGL03185:Fkbp15 APN 4 62332186 splice site probably null
IGL03280:Fkbp15 APN 4 62303267 unclassified probably benign
dura UTSW 4 62324126 missense probably damaging 0.96
mater UTSW 4 62326136 missense probably benign 0.22
R0419:Fkbp15 UTSW 4 62326136 missense probably benign 0.22
R0838:Fkbp15 UTSW 4 62324126 missense probably damaging 0.96
R1241:Fkbp15 UTSW 4 62304609 missense possibly damaging 0.87
R1394:Fkbp15 UTSW 4 62327872 missense probably benign 0.00
R1622:Fkbp15 UTSW 4 62323202 missense possibly damaging 0.94
R1682:Fkbp15 UTSW 4 62324194 missense probably damaging 0.98
R1823:Fkbp15 UTSW 4 62337091 missense probably damaging 1.00
R1994:Fkbp15 UTSW 4 62304381 missense probably benign 0.00
R2132:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2133:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2425:Fkbp15 UTSW 4 62312365 missense probably benign 0.00
R2938:Fkbp15 UTSW 4 62304663 missense probably benign 0.23
R3034:Fkbp15 UTSW 4 62306892 splice site probably null
R3957:Fkbp15 UTSW 4 62334252 missense probably benign 0.01
R3963:Fkbp15 UTSW 4 62340677 missense probably damaging 1.00
R4235:Fkbp15 UTSW 4 62336456 missense probably benign 0.38
R4334:Fkbp15 UTSW 4 62303219 missense possibly damaging 0.95
R4366:Fkbp15 UTSW 4 62336414 missense probably benign 0.38
R4717:Fkbp15 UTSW 4 62308069 missense probably damaging 1.00
R4790:Fkbp15 UTSW 4 62307997 missense probably benign 0.05
R5075:Fkbp15 UTSW 4 62321029 missense probably damaging 0.96
R5176:Fkbp15 UTSW 4 62312323 missense possibly damaging 0.68
R5419:Fkbp15 UTSW 4 62327877 missense probably damaging 0.98
R5503:Fkbp15 UTSW 4 62327887 missense probably benign 0.05
R5731:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5733:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5820:Fkbp15 UTSW 4 62345546 missense probably benign 0.00
R5878:Fkbp15 UTSW 4 62306908 missense probably benign
R5898:Fkbp15 UTSW 4 62326057 critical splice donor site probably null
R5914:Fkbp15 UTSW 4 62327810 splice site probably null
R6113:Fkbp15 UTSW 4 62340647 missense probably benign 0.38
R6377:Fkbp15 UTSW 4 62324192 missense probably damaging 1.00
R6427:Fkbp15 UTSW 4 62323202 missense probably benign 0.01
R6464:Fkbp15 UTSW 4 62308078 missense possibly damaging 0.92
R6528:Fkbp15 UTSW 4 62332270 missense probably damaging 1.00
R6790:Fkbp15 UTSW 4 62304759 missense probably benign 0.01
R6880:Fkbp15 UTSW 4 62336495 missense possibly damaging 0.71
R6911:Fkbp15 UTSW 4 62340290 missense probably damaging 1.00
R7371:Fkbp15 UTSW 4 62321056 missense possibly damaging 0.89
R7410:Fkbp15 UTSW 4 62340299 missense probably damaging 1.00
X0013:Fkbp15 UTSW 4 62312370 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- AGCTCAGTCCTTCACGAGTG -3'
(R):5'- CAGTGCAGGTGGAAGGTATC -3'

Sequencing Primer
(F):5'- AGTCCTTCACGAGTGCCATGAG -3'
(R):5'- GGAAGGTATCCTTTCCTCCCTTCAG -3'
Posted On2019-11-12