Incidental Mutation 'R7660:Rgs3'
ID 591491
Institutional Source Beutler Lab
Gene Symbol Rgs3
Ensembl Gene ENSMUSG00000059810
Gene Name regulator of G-protein signaling 3
Synonyms C2pa, PDZ-RGS3, RGS3S, C2PA-RGS3, 4930506N09Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.109) question?
Stock # R7660 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 62559847-62704001 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 62701112 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 478 (D478G)
Ref Sequence ENSEMBL: ENSMUSP00000103043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084521] [ENSMUST00000107420]
AlphaFold Q9DC04
Predicted Effect possibly damaging
Transcript: ENSMUST00000084521
AA Change: D876G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081569
Gene: ENSMUSG00000059810
AA Change: D876G

DomainStartEndE-ValueType
PDZ 26 95 8.09e-10 SMART
low complexity region 288 298 N/A INTRINSIC
internal_repeat_1 407 447 2.05e-9 PROSPERO
internal_repeat_1 456 501 2.05e-9 PROSPERO
low complexity region 645 674 N/A INTRINSIC
RGS 841 957 3.66e-53 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107420
AA Change: D478G

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103043
Gene: ENSMUSG00000059810
AA Change: D478G

DomainStartEndE-ValueType
internal_repeat_1 9 49 1.41e-9 PROSPERO
internal_repeat_1 58 103 1.41e-9 PROSPERO
low complexity region 247 276 N/A INTRINSIC
RGS 443 559 3.66e-53 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000123310
Gene: ENSMUSG00000059810
AA Change: D35G

DomainStartEndE-ValueType
RGS 1 117 8.1e-46 SMART
Meta Mutation Damage Score 0.7225 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling (RGS) family. This protein is a GTPase-activating protein that inhibits G-protein-mediated signal transduction. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. Long isoforms are largely cytosolic and plasma membrane-associated with a function in Wnt signaling and in the epithelial mesenchymal transition, while shorter N-terminally-truncated isoforms can be nuclear. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired T cell migration in model of Th2-mediated airway inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,860,719 H142L possibly damaging Het
Abca13 A G 11: 9,290,678 E847G probably benign Het
Abca9 T A 11: 110,115,452 T1276S probably benign Het
Abcb11 C T 2: 69,287,594 probably null Het
AF366264 A T 8: 13,837,995 I32K probably benign Het
Alpk1 G C 3: 127,680,967 H462Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atm C T 9: 53,445,507 V2815M probably benign Het
Braf T C 6: 39,623,641 I681V possibly damaging Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Crybg1 T C 10: 43,998,835 D759G probably damaging Het
Csrp2 A G 10: 110,937,763 N103S probably benign Het
Faf1 A T 4: 109,861,837 H380L probably damaging Het
Farp1 G A 14: 121,276,922 A888T probably benign Het
Fat4 A T 3: 38,981,160 Q2987L probably benign Het
Fkbp15 T A 4: 62,314,341 T665S probably benign Het
Gigyf1 T C 5: 137,520,969 S343P probably benign Het
Glrx3 A G 7: 137,459,225 Y196C probably damaging Het
Gm3278 T G 14: 4,893,349 L66R probably damaging Het
Gm8298 A G 3: 59,865,268 I64M probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 A G 1: 174,028,248 V72A probably benign Het
Ift140 T G 17: 25,051,824 L708R probably damaging Het
Ints13 A T 6: 146,557,338 L328M probably benign Het
Itfg2 A G 6: 128,424,746 I23T probably damaging Het
Ldha C T 7: 46,850,257 P100S unknown Het
Lmtk2 T A 5: 144,148,340 L210H probably damaging Het
Lrrc4 T A 6: 28,829,817 I600L probably benign Het
Map2 C A 1: 66,414,377 P809T probably damaging Het
Matn2 A G 15: 34,402,946 K439R probably benign Het
Matn2 T A 15: 34,423,728 C577* probably null Het
Mep1a C T 17: 43,478,977 G494S probably benign Het
Mtmr4 T C 11: 87,604,580 F488L probably damaging Het
Mtus1 G T 8: 41,016,211 T8K probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mybpc1 T C 10: 88,548,854 T523A possibly damaging Het
Ncoa3 C T 2: 166,069,321 P1334S probably benign Het
Neb T G 2: 52,249,439 M119L Het
Nox4 T C 7: 87,370,022 Y408H probably damaging Het
Nxpe3 C T 16: 55,844,327 R510Q probably damaging Het
Olfr1077-ps1 A T 2: 86,525,830 S116T possibly damaging Het
Olfr1275 C T 2: 111,231,615 M59I probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr484 A G 7: 108,124,834 V143A probably benign Het
Olfr807 C A 10: 129,754,563 E296* probably null Het
Olfr839-ps1 T C 9: 19,175,508 H56R probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pax8 T C 2: 24,436,561 Y263C probably benign Het
Pcdha11 T A 18: 37,005,851 Y178N probably benign Het
Pcdhga11 C T 18: 37,757,130 T397M possibly damaging Het
Pdlim5 G T 3: 142,259,185 H428N probably damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Scgb2b11 C T 7: 32,210,458 E68K probably damaging Het
Sema4b C A 7: 80,220,247 Q428K probably benign Het
Serpine2 T C 1: 79,802,905 T276A probably benign Het
Sgo2b G A 8: 63,940,074 H110Y probably benign Het
Slc12a7 T C 13: 73,806,089 L833S probably benign Het
Slc6a15 T A 10: 103,393,380 probably null Het
Srfbp1 G A 18: 52,475,599 V24I probably damaging Het
Stpg2 A T 3: 139,701,697 N537Y probably damaging Het
Svep1 A T 4: 58,087,782 S1766T probably benign Het
Tiam2 T A 17: 3,482,605 M1K probably null Het
Tmem245 A T 4: 56,899,170 I661K possibly damaging Het
Trim5 T C 7: 104,279,362 H124R probably damaging Het
Trim67 T A 8: 124,820,285 L478Q probably damaging Het
Triml2 A G 8: 43,193,320 D282G probably damaging Het
Txndc11 T C 16: 11,087,929 Y579C probably damaging Het
Ube3c T A 5: 29,619,631 D551E probably damaging Het
Vmn1r194 T C 13: 22,244,597 V128A not run Het
Vmn2r70 T G 7: 85,568,922 N56T probably damaging Het
Vmn2r-ps130 T A 17: 23,077,032 D725E probably damaging Het
Wdr95 T C 5: 149,594,480 V501A possibly damaging Het
Zc3h8 T C 2: 128,930,822 T249A probably damaging Het
Zfp54 T C 17: 21,434,239 C332R probably damaging Het
Other mutations in Rgs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Rgs3 APN 4 62701180 missense possibly damaging 0.87
IGL00918:Rgs3 APN 4 62701067 missense probably damaging 1.00
IGL01594:Rgs3 APN 4 62619744 missense probably damaging 0.99
IGL01761:Rgs3 APN 4 62652709 splice site probably benign
IGL02995:Rgs3 APN 4 62625847 missense possibly damaging 0.95
IGL03365:Rgs3 APN 4 62689675 missense probably benign
R0098:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0098:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0158:Rgs3 UTSW 4 62623884 missense probably damaging 1.00
R0609:Rgs3 UTSW 4 62625936 missense probably damaging 1.00
R0633:Rgs3 UTSW 4 62625906 missense probably damaging 1.00
R0637:Rgs3 UTSW 4 62646673 splice site probably benign
R0893:Rgs3 UTSW 4 62605561 splice site probably null
R1612:Rgs3 UTSW 4 62625935 missense probably damaging 0.99
R1929:Rgs3 UTSW 4 62702147 missense probably damaging 1.00
R2202:Rgs3 UTSW 4 62690504 missense probably damaging 1.00
R2239:Rgs3 UTSW 4 62625887 missense probably benign 0.30
R2380:Rgs3 UTSW 4 62625887 missense probably benign 0.30
R2974:Rgs3 UTSW 4 62640720 missense probably damaging 1.00
R4871:Rgs3 UTSW 4 62631295 missense probably benign 0.01
R5229:Rgs3 UTSW 4 62702187 missense probably damaging 1.00
R5372:Rgs3 UTSW 4 62652697 intron probably benign
R5597:Rgs3 UTSW 4 62623845 missense probably damaging 1.00
R6006:Rgs3 UTSW 4 62623906 missense probably damaging 1.00
R6056:Rgs3 UTSW 4 62625906 missense probably damaging 0.96
R6732:Rgs3 UTSW 4 62602943 missense probably benign 0.00
R6962:Rgs3 UTSW 4 62700715 intron probably benign
R7141:Rgs3 UTSW 4 62690487 missense probably damaging 1.00
R7156:Rgs3 UTSW 4 62617126 missense probably damaging 0.99
R7193:Rgs3 UTSW 4 62615336 missense probably damaging 0.99
R7459:Rgs3 UTSW 4 62625154 missense probably benign 0.01
R7697:Rgs3 UTSW 4 62657142 missense probably benign 0.00
R8025:Rgs3 UTSW 4 62690594 missense probably damaging 0.97
R8059:Rgs3 UTSW 4 62602977 splice site probably benign
R8242:Rgs3 UTSW 4 62619785 missense probably benign
R8413:Rgs3 UTSW 4 62626017 missense possibly damaging 0.54
R8489:Rgs3 UTSW 4 62626496 missense probably damaging 1.00
R8501:Rgs3 UTSW 4 62602956 missense possibly damaging 0.85
R8880:Rgs3 UTSW 4 62625136 missense probably damaging 1.00
R9065:Rgs3 UTSW 4 62702228 missense probably benign 0.05
R9094:Rgs3 UTSW 4 62582003 missense probably damaging 1.00
R9318:Rgs3 UTSW 4 62640782 missense probably benign 0.05
R9483:Rgs3 UTSW 4 62657117 nonsense probably null
R9498:Rgs3 UTSW 4 62657175 missense probably damaging 1.00
R9522:Rgs3 UTSW 4 62605492 missense probably benign 0.12
Z1177:Rgs3 UTSW 4 62631214 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTGCTAAGTTCCCAACACATTCC -3'
(R):5'- AACATTCTGTTCACTGGGCCTC -3'

Sequencing Primer
(F):5'- ATTCCCTCAAGGCTCTTGGAGG -3'
(R):5'- TCCTGGCAGACTAGATACTCTAAGAG -3'
Posted On 2019-11-12