Incidental Mutation 'R7660:Lmtk2'
ID 591498
Institutional Source Beutler Lab
Gene Symbol Lmtk2
Ensembl Gene ENSMUSG00000038970
Gene Name lemur tyrosine kinase 2
Synonyms BREK, AATYK2, A330101P12Rik, KPI2, KPI-2, 2900041G10Rik, cprk
MMRRC Submission 045735-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.526) question?
Stock # R7660 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 144037254-144125022 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144085158 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 210 (L210H)
Ref Sequence ENSEMBL: ENSMUSP00000048238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041804]
AlphaFold Q3TYD6
Predicted Effect probably damaging
Transcript: ENSMUST00000041804
AA Change: L210H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048238
Gene: ENSMUSG00000038970
AA Change: L210H

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 42 61 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
STYKc 136 406 3.4e-39 SMART
low complexity region 924 953 N/A INTRINSIC
low complexity region 1019 1035 N/A INTRINSIC
low complexity region 1104 1117 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1354 1367 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase superfamily and the protein tyrosine kinase family. It contains N-terminal transmembrane helices and a long C-terminal cytoplasmic tail with serine/threonine/tyrosine kinase activity. This protein interacts with several other proteins, such as Inhibitor-2 (Inh2), protein phosphatase-1 (PP1C), p35, and myosin VI. It phosporylates other proteins, and is itself also phosporylated when interacting with cyclin-dependent kinase 5 (cdk5)/p35 complex. This protein involves in nerve growth factor (NGF)-TrkA signalling, and also plays a critical role in endosomal membrane trafficking. Mouse studies suggested an essential role of this protein in spermatogenesis. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null mutation in this gene display partial prenatal lethality, male infertility, and azoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(31) : Targeted, knock-out(1) Gene trapped(30)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,754,512 (GRCm39) H142L possibly damaging Het
Aadacl2fm3 A G 3: 59,772,689 (GRCm39) I64M probably benign Het
Abca13 A G 11: 9,240,678 (GRCm39) E847G probably benign Het
Abca9 T A 11: 110,006,278 (GRCm39) T1276S probably benign Het
Abcb11 C T 2: 69,117,938 (GRCm39) probably null Het
Alpk1 G C 3: 127,474,616 (GRCm39) H462Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atm C T 9: 53,356,807 (GRCm39) V2815M probably benign Het
Braf T C 6: 39,600,575 (GRCm39) I681V possibly damaging Het
Casc3 C G 11: 98,700,699 (GRCm39) R4G unknown Het
Cilk1 G C 9: 78,074,902 (GRCm39) V586L probably benign Het
Crybg1 T C 10: 43,874,831 (GRCm39) D759G probably damaging Het
Csrp2 A G 10: 110,773,624 (GRCm39) N103S probably benign Het
Faf1 A T 4: 109,719,034 (GRCm39) H380L probably damaging Het
Farp1 G A 14: 121,514,334 (GRCm39) A888T probably benign Het
Fat4 A T 3: 39,035,309 (GRCm39) Q2987L probably benign Het
Fkbp15 T A 4: 62,232,578 (GRCm39) T665S probably benign Het
Gigyf1 T C 5: 137,519,231 (GRCm39) S343P probably benign Het
Glrx3 A G 7: 137,060,954 (GRCm39) Y196C probably damaging Het
Gm3278 T G 14: 16,080,387 (GRCm39) L66R probably damaging Het
Ifi205 A G 1: 173,855,814 (GRCm39) V72A probably benign Het
Ift140 T G 17: 25,270,798 (GRCm39) L708R probably damaging Het
Ints13 A T 6: 146,458,836 (GRCm39) L328M probably benign Het
Itfg2 A G 6: 128,401,709 (GRCm39) I23T probably damaging Het
Ldha C T 7: 46,499,681 (GRCm39) P100S unknown Het
Lrrc4 T A 6: 28,829,816 (GRCm39) I600L probably benign Het
Map2 C A 1: 66,453,536 (GRCm39) P809T probably damaging Het
Matn2 T A 15: 34,423,874 (GRCm39) C577* probably null Het
Matn2 A G 15: 34,403,092 (GRCm39) K439R probably benign Het
Mep1a C T 17: 43,789,868 (GRCm39) G494S probably benign Het
Mtmr4 T C 11: 87,495,406 (GRCm39) F488L probably damaging Het
Mtus1 G T 8: 41,469,248 (GRCm39) T8K probably benign Het
Mug1 C A 6: 121,838,179 (GRCm39) H470N possibly damaging Het
Mybpc1 T C 10: 88,384,716 (GRCm39) T523A possibly damaging Het
Ncoa3 C T 2: 165,911,241 (GRCm39) P1334S probably benign Het
Neb T G 2: 52,139,451 (GRCm39) M119L Het
Nox4 T C 7: 87,019,230 (GRCm39) Y408H probably damaging Het
Nxpe3 C T 16: 55,664,690 (GRCm39) R510Q probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or4f52 C T 2: 111,061,960 (GRCm39) M59I probably damaging Het
Or5p60 A G 7: 107,724,041 (GRCm39) V143A probably benign Het
Or6c214 C A 10: 129,590,432 (GRCm39) E296* probably null Het
Or7g23 T C 9: 19,086,804 (GRCm39) H56R probably benign Het
Or8k31-ps1 A T 2: 86,356,174 (GRCm39) S116T possibly damaging Het
Paip1 C T 13: 119,587,306 (GRCm39) T390I possibly damaging Het
Pax8 T C 2: 24,326,573 (GRCm39) Y263C probably benign Het
Pcdha11 T A 18: 37,138,904 (GRCm39) Y178N probably benign Het
Pcdhga11 C T 18: 37,890,183 (GRCm39) T397M possibly damaging Het
Pdlim5 G T 3: 141,964,946 (GRCm39) H428N probably damaging Het
Pigg G A 5: 108,486,485 (GRCm39) V713I probably benign Het
Rgs3 A G 4: 62,619,349 (GRCm39) D478G possibly damaging Het
Scgb2b11 C T 7: 31,909,883 (GRCm39) E68K probably damaging Het
Sema4b C A 7: 79,869,995 (GRCm39) Q428K probably benign Het
Semp2l2a A T 8: 13,887,995 (GRCm39) I32K probably benign Het
Serpine2 T C 1: 79,780,622 (GRCm39) T276A probably benign Het
Sgo2b G A 8: 64,393,108 (GRCm39) H110Y probably benign Het
Slc12a7 T C 13: 73,954,208 (GRCm39) L833S probably benign Het
Slc6a15 T A 10: 103,229,241 (GRCm39) probably null Het
Srfbp1 G A 18: 52,608,671 (GRCm39) V24I probably damaging Het
Stpg2 A T 3: 139,407,458 (GRCm39) N537Y probably damaging Het
Svep1 A T 4: 58,087,782 (GRCm39) S1766T probably benign Het
Tiam2 T A 17: 3,532,880 (GRCm39) M1K probably null Het
Tmem245 A T 4: 56,899,170 (GRCm39) I661K possibly damaging Het
Trim5 T C 7: 103,928,569 (GRCm39) H124R probably damaging Het
Trim67 T A 8: 125,547,024 (GRCm39) L478Q probably damaging Het
Triml2 A G 8: 43,646,357 (GRCm39) D282G probably damaging Het
Txndc11 T C 16: 10,905,793 (GRCm39) Y579C probably damaging Het
Ube3c T A 5: 29,824,629 (GRCm39) D551E probably damaging Het
Vmn1r194 T C 13: 22,428,767 (GRCm39) V128A not run Het
Vmn2r130 T A 17: 23,296,006 (GRCm39) D725E probably damaging Het
Vmn2r70 T G 7: 85,218,130 (GRCm39) N56T probably damaging Het
Wdr95 T C 5: 149,517,945 (GRCm39) V501A possibly damaging Het
Zc3h8 T C 2: 128,772,742 (GRCm39) T249A probably damaging Het
Zfp54 T C 17: 21,654,501 (GRCm39) C332R probably damaging Het
Other mutations in Lmtk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Lmtk2 APN 5 144,070,973 (GRCm39) missense probably damaging 1.00
IGL00496:Lmtk2 APN 5 144,111,512 (GRCm39) missense probably benign
IGL00848:Lmtk2 APN 5 144,113,216 (GRCm39) missense probably benign
IGL01450:Lmtk2 APN 5 144,111,520 (GRCm39) missense probably benign 0.03
IGL01833:Lmtk2 APN 5 144,112,753 (GRCm39) nonsense probably null
IGL01967:Lmtk2 APN 5 144,119,597 (GRCm39) missense probably benign
IGL01998:Lmtk2 APN 5 144,112,883 (GRCm39) missense probably damaging 1.00
IGL02106:Lmtk2 APN 5 144,112,769 (GRCm39) missense probably benign 0.03
IGL02147:Lmtk2 APN 5 144,093,754 (GRCm39) missense possibly damaging 0.78
IGL02581:Lmtk2 APN 5 144,085,166 (GRCm39) missense probably damaging 1.00
madagascar UTSW 5 144,111,737 (GRCm39) missense probably benign 0.02
A4554:Lmtk2 UTSW 5 144,103,135 (GRCm39) missense possibly damaging 0.82
R0039:Lmtk2 UTSW 5 144,103,205 (GRCm39) missense probably damaging 1.00
R0039:Lmtk2 UTSW 5 144,103,205 (GRCm39) missense probably damaging 1.00
R0108:Lmtk2 UTSW 5 144,111,103 (GRCm39) missense possibly damaging 0.78
R0367:Lmtk2 UTSW 5 144,111,103 (GRCm39) missense possibly damaging 0.78
R0515:Lmtk2 UTSW 5 144,111,809 (GRCm39) missense possibly damaging 0.77
R1434:Lmtk2 UTSW 5 144,111,407 (GRCm39) missense probably damaging 1.00
R1617:Lmtk2 UTSW 5 144,110,680 (GRCm39) missense probably damaging 1.00
R1760:Lmtk2 UTSW 5 144,110,993 (GRCm39) missense probably damaging 0.99
R1785:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R1786:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R1907:Lmtk2 UTSW 5 144,111,928 (GRCm39) missense probably benign 0.00
R2130:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2131:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2132:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2133:Lmtk2 UTSW 5 144,111,806 (GRCm39) missense possibly damaging 0.61
R2140:Lmtk2 UTSW 5 144,084,433 (GRCm39) missense probably damaging 1.00
R2141:Lmtk2 UTSW 5 144,084,433 (GRCm39) missense probably damaging 1.00
R2210:Lmtk2 UTSW 5 144,084,427 (GRCm39) missense probably damaging 1.00
R2289:Lmtk2 UTSW 5 144,112,924 (GRCm39) missense possibly damaging 0.80
R2312:Lmtk2 UTSW 5 144,110,444 (GRCm39) missense probably damaging 1.00
R2352:Lmtk2 UTSW 5 144,110,729 (GRCm39) missense probably benign 0.05
R3870:Lmtk2 UTSW 5 144,103,245 (GRCm39) splice site probably benign
R4011:Lmtk2 UTSW 5 144,112,697 (GRCm39) missense probably benign 0.01
R4272:Lmtk2 UTSW 5 144,120,044 (GRCm39) missense probably benign 0.05
R4361:Lmtk2 UTSW 5 144,084,482 (GRCm39) missense probably damaging 1.00
R4580:Lmtk2 UTSW 5 144,111,599 (GRCm39) missense possibly damaging 0.56
R4621:Lmtk2 UTSW 5 144,111,752 (GRCm39) missense probably benign 0.02
R4981:Lmtk2 UTSW 5 144,113,265 (GRCm39) missense probably damaging 1.00
R5818:Lmtk2 UTSW 5 144,093,718 (GRCm39) missense probably benign 0.07
R5984:Lmtk2 UTSW 5 144,111,656 (GRCm39) missense probably benign
R6083:Lmtk2 UTSW 5 144,119,574 (GRCm39) missense probably damaging 1.00
R6180:Lmtk2 UTSW 5 144,112,160 (GRCm39) missense probably damaging 1.00
R6411:Lmtk2 UTSW 5 144,111,404 (GRCm39) missense probably damaging 0.99
R6544:Lmtk2 UTSW 5 144,110,624 (GRCm39) missense possibly damaging 0.68
R6628:Lmtk2 UTSW 5 144,111,503 (GRCm39) missense probably benign 0.03
R6698:Lmtk2 UTSW 5 144,111,737 (GRCm39) missense probably benign 0.02
R6742:Lmtk2 UTSW 5 144,085,175 (GRCm39) missense probably damaging 1.00
R6763:Lmtk2 UTSW 5 144,110,615 (GRCm39) missense probably damaging 1.00
R7286:Lmtk2 UTSW 5 144,111,178 (GRCm39) nonsense probably null
R7390:Lmtk2 UTSW 5 144,066,261 (GRCm39) missense possibly damaging 0.79
R7594:Lmtk2 UTSW 5 144,110,564 (GRCm39) missense probably damaging 1.00
R7785:Lmtk2 UTSW 5 144,111,571 (GRCm39) missense probably benign 0.00
R7977:Lmtk2 UTSW 5 144,111,959 (GRCm39) missense probably benign 0.02
R7987:Lmtk2 UTSW 5 144,111,959 (GRCm39) missense probably benign 0.02
R8089:Lmtk2 UTSW 5 144,093,718 (GRCm39) missense probably benign 0.07
R8138:Lmtk2 UTSW 5 144,112,415 (GRCm39) missense probably damaging 0.99
R8694:Lmtk2 UTSW 5 144,108,566 (GRCm39) missense probably damaging 1.00
R8714:Lmtk2 UTSW 5 144,112,876 (GRCm39) missense probably damaging 1.00
R8816:Lmtk2 UTSW 5 144,112,793 (GRCm39) nonsense probably null
R8845:Lmtk2 UTSW 5 144,110,704 (GRCm39) missense probably damaging 1.00
R8856:Lmtk2 UTSW 5 144,113,079 (GRCm39) missense probably damaging 1.00
R9306:Lmtk2 UTSW 5 144,119,599 (GRCm39) missense probably benign 0.17
R9494:Lmtk2 UTSW 5 144,037,338 (GRCm39) start gained probably benign
X0024:Lmtk2 UTSW 5 144,111,068 (GRCm39) missense probably benign 0.22
Z1088:Lmtk2 UTSW 5 144,119,669 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CTCGCTCTGATAGGGAAAATACAG -3'
(R):5'- AACGGTAACAGCTCAGCTCG -3'

Sequencing Primer
(F):5'- GAACTCTGCCTCCTTGAAGAGTG -3'
(R):5'- TAACAGCTCAGCTCGGGGTC -3'
Posted On 2019-11-12