Incidental Mutation 'R7660:Wdr95'
ID591499
Institutional Source Beutler Lab
Gene Symbol Wdr95
Ensembl Gene ENSMUSG00000029658
Gene NameWD40 repeat domain 95
Synonyms4930434E21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7660 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location149528679-149611894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149594480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 501 (V501A)
Ref Sequence ENSEMBL: ENSMUSP00000144385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110502] [ENSMUST00000201525] [ENSMUST00000202902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110502
AA Change: V359A

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106128
Gene: ENSMUSG00000029658
AA Change: V359A

DomainStartEndE-ValueType
Pfam:WD40 4 28 3.3e-3 PFAM
WD40 32 71 4.38e-5 SMART
WD40 120 159 3.27e-4 SMART
WD40 162 203 1.71e-7 SMART
WD40 206 249 3.57e0 SMART
WD40 263 301 1.7e-2 SMART
Blast:WD40 315 363 3e-14 BLAST
Blast:WD40 367 408 4e-13 BLAST
WD40 421 460 2.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201525
SMART Domains Protein: ENSMUSP00000144234
Gene: ENSMUSG00000029658

DomainStartEndE-ValueType
WD40 104 143 2e-6 SMART
WD40 146 187 1.1e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000202902
AA Change: V501A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144385
Gene: ENSMUSG00000029658
AA Change: V501A

DomainStartEndE-ValueType
Blast:WD40 44 83 9e-11 BLAST
WD40 132 170 1.61e-3 SMART
WD40 174 213 4.38e-5 SMART
WD40 262 301 3.27e-4 SMART
WD40 304 345 1.71e-7 SMART
WD40 348 391 3.57e0 SMART
WD40 405 443 1.7e-2 SMART
Blast:WD40 457 505 3e-14 BLAST
Blast:WD40 509 550 4e-13 BLAST
WD40 563 602 2.01e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,860,719 H142L possibly damaging Het
Abca13 A G 11: 9,290,678 E847G probably benign Het
Abca9 T A 11: 110,115,452 T1276S probably benign Het
AF366264 A T 8: 13,837,995 I32K probably benign Het
Alpk1 G C 3: 127,680,967 H462Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atm C T 9: 53,445,507 V2815M probably benign Het
Braf T C 6: 39,623,641 I681V possibly damaging Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Crybg1 T C 10: 43,998,835 D759G probably damaging Het
Csrp2 A G 10: 110,937,763 N103S probably benign Het
Faf1 A T 4: 109,861,837 H380L probably damaging Het
Farp1 G A 14: 121,276,922 A888T probably benign Het
Fat4 A T 3: 38,981,160 Q2987L probably benign Het
Fkbp15 T A 4: 62,314,341 T665S probably benign Het
Gigyf1 T C 5: 137,520,969 S343P probably benign Het
Glrx3 A G 7: 137,459,225 Y196C probably damaging Het
Gm3278 T G 14: 4,893,349 L66R probably damaging Het
Gm8298 A G 3: 59,865,268 I64M probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 A G 1: 174,028,248 V72A probably benign Het
Ift140 T G 17: 25,051,824 L708R probably damaging Het
Ints13 A T 6: 146,557,338 L328M probably benign Het
Itfg2 A G 6: 128,424,746 I23T probably damaging Het
Ldha C T 7: 46,850,257 P100S unknown Het
Lmtk2 T A 5: 144,148,340 L210H probably damaging Het
Lrrc4 T A 6: 28,829,817 I600L probably benign Het
Map2 C A 1: 66,414,377 P809T probably damaging Het
Matn2 A G 15: 34,402,946 K439R probably benign Het
Matn2 T A 15: 34,423,728 C577* probably null Het
Mep1a C T 17: 43,478,977 G494S probably benign Het
Mtmr4 T C 11: 87,604,580 F488L probably damaging Het
Mtus1 G T 8: 41,016,211 T8K probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mybpc1 T C 10: 88,548,854 T523A possibly damaging Het
Ncoa3 C T 2: 166,069,321 P1334S probably benign Het
Neb T G 2: 52,249,439 M119L Het
Nox4 T C 7: 87,370,022 Y408H probably damaging Het
Nxpe3 C T 16: 55,844,327 R510Q probably damaging Het
Olfr1077-ps1 A T 2: 86,525,830 S116T possibly damaging Het
Olfr1275 C T 2: 111,231,615 M59I probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr484 A G 7: 108,124,834 V143A probably benign Het
Olfr807 C A 10: 129,754,563 E296* probably null Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pax8 T C 2: 24,436,561 Y263C probably benign Het
Pcdha11 T A 18: 37,005,851 Y178N probably benign Het
Pcdhga11 C T 18: 37,757,130 T397M possibly damaging Het
Pdlim5 G T 3: 142,259,185 H428N probably damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Rgs3 A G 4: 62,701,112 D478G possibly damaging Het
Scgb2b11 C T 7: 32,210,458 E68K probably damaging Het
Sema4b C A 7: 80,220,247 Q428K probably benign Het
Serpine2 T C 1: 79,802,905 T276A probably benign Het
Sgo2b G A 8: 63,940,074 H110Y probably benign Het
Slc12a7 T C 13: 73,806,089 L833S probably benign Het
Srfbp1 G A 18: 52,475,599 V24I probably damaging Het
Stpg2 A T 3: 139,701,697 N537Y probably damaging Het
Svep1 A T 4: 58,087,782 S1766T probably benign Het
Tiam2 T A 17: 3,482,605 M1K probably null Het
Tmem245 A T 4: 56,899,170 I661K possibly damaging Het
Trim5 T C 7: 104,279,362 H124R probably damaging Het
Trim67 T A 8: 124,820,285 L478Q probably damaging Het
Triml2 A G 8: 43,193,320 D282G probably damaging Het
Txndc11 T C 16: 11,087,929 Y579C probably damaging Het
Ube3c T A 5: 29,619,631 D551E probably damaging Het
Vmn1r194 T C 13: 22,244,597 V128A not run Het
Vmn2r70 T G 7: 85,568,922 N56T probably damaging Het
Vmn2r-ps130 T A 17: 23,077,032 D725E probably damaging Het
Zc3h8 T C 2: 128,930,822 T249A probably damaging Het
Zfp54 T C 17: 21,434,239 C332R probably damaging Het
Other mutations in Wdr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Wdr95 APN 5 149595244 critical splice acceptor site probably benign 0.00
IGL02352:Wdr95 APN 5 149580619 missense probably damaging 0.99
IGL02359:Wdr95 APN 5 149580619 missense probably damaging 0.99
IGL02478:Wdr95 APN 5 149596321 missense probably benign 0.02
IGL03078:Wdr95 APN 5 149611597 missense possibly damaging 0.63
IGL03201:Wdr95 APN 5 149581887 splice site probably null
P0037:Wdr95 UTSW 5 149588071 missense probably benign 0.27
R0115:Wdr95 UTSW 5 149564390 missense probably damaging 1.00
R0538:Wdr95 UTSW 5 149580806 missense probably damaging 1.00
R0606:Wdr95 UTSW 5 149588130 missense probably damaging 1.00
R0723:Wdr95 UTSW 5 149574048 missense probably damaging 1.00
R1104:Wdr95 UTSW 5 149606337 missense probably benign 0.00
R1233:Wdr95 UTSW 5 149581858 missense possibly damaging 0.61
R1233:Wdr95 UTSW 5 149595364 missense probably benign 0.00
R1344:Wdr95 UTSW 5 149588098 missense probably damaging 1.00
R1513:Wdr95 UTSW 5 149599294 missense probably benign 0.00
R1623:Wdr95 UTSW 5 149574116 missense probably damaging 1.00
R1633:Wdr95 UTSW 5 149593172 missense probably damaging 0.98
R1664:Wdr95 UTSW 5 149595287 missense probably damaging 0.98
R1686:Wdr95 UTSW 5 149593101 missense probably damaging 1.00
R1741:Wdr95 UTSW 5 149595396 splice site probably null
R1750:Wdr95 UTSW 5 149581886 splice site probably null
R1774:Wdr95 UTSW 5 149564392 nonsense probably null
R1831:Wdr95 UTSW 5 149552426 missense probably damaging 1.00
R1838:Wdr95 UTSW 5 149599366 missense probably benign 0.00
R1907:Wdr95 UTSW 5 149552426 missense probably damaging 1.00
R2019:Wdr95 UTSW 5 149574148 splice site probably benign
R2063:Wdr95 UTSW 5 149579162 splice site probably null
R2392:Wdr95 UTSW 5 149580670 missense probably benign 0.03
R2863:Wdr95 UTSW 5 149581856 nonsense probably null
R4116:Wdr95 UTSW 5 149597575 missense probably benign 0.02
R4237:Wdr95 UTSW 5 149563337 nonsense probably null
R4420:Wdr95 UTSW 5 149532666 missense probably damaging 0.99
R4639:Wdr95 UTSW 5 149581814 splice site probably benign
R4824:Wdr95 UTSW 5 149595332 missense probably damaging 1.00
R4911:Wdr95 UTSW 5 149611692 nonsense probably null
R5016:Wdr95 UTSW 5 149544801 missense probably benign 0.00
R5458:Wdr95 UTSW 5 149564414 missense probably damaging 1.00
R5486:Wdr95 UTSW 5 149596330 nonsense probably null
R5613:Wdr95 UTSW 5 149584470 missense probably damaging 1.00
R5906:Wdr95 UTSW 5 149564227 missense possibly damaging 0.50
R5956:Wdr95 UTSW 5 149594482 missense probably benign 0.00
R6309:Wdr95 UTSW 5 149580803 critical splice acceptor site probably null
R6867:Wdr95 UTSW 5 149580923 intron probably null
R6964:Wdr95 UTSW 5 149581850 missense probably damaging 1.00
R7008:Wdr95 UTSW 5 149611540 missense probably benign 0.00
R7208:Wdr95 UTSW 5 149595371 missense probably benign 0.02
R7309:Wdr95 UTSW 5 149606293 missense probably benign 0.01
R7504:Wdr95 UTSW 5 149581846 missense probably damaging 0.99
R7997:Wdr95 UTSW 5 149579157 critical splice donor site probably null
X0024:Wdr95 UTSW 5 149588167 missense possibly damaging 0.81
Z1176:Wdr95 UTSW 5 149566436 missense probably benign 0.34
Z1177:Wdr95 UTSW 5 149544776 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTAGTGGAGGAGAACCCAGC -3'
(R):5'- GCAAAGAATTGGAACCTGGC -3'

Sequencing Primer
(F):5'- GAGGAGAACCCAGCAAGTCATC -3'
(R):5'- AATTGGAACCTGGCAGACC -3'
Posted On2019-11-12