Incidental Mutation 'R7660:Trim67'
ID591517
Institutional Source Beutler Lab
Gene Symbol Trim67
Ensembl Gene ENSMUSG00000036913
Gene Nametripartite motif-containing 67
SynonymsD130049O21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R7660 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124793092-124834713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124820285 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 478 (L478Q)
Ref Sequence ENSEMBL: ENSMUSP00000040601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041106] [ENSMUST00000167588] [ENSMUST00000211867]
Predicted Effect probably damaging
Transcript: ENSMUST00000041106
AA Change: L478Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040601
Gene: ENSMUSG00000036913
AA Change: L478Q

DomainStartEndE-ValueType
RING 7 157 1.41e-4 SMART
BBOX 198 248 4.65e-5 SMART
BBOX 285 327 3.04e-9 SMART
BBC 334 460 1.18e-28 SMART
FN3 498 579 1.75e-6 SMART
Pfam:SPRY 635 755 1.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167588
AA Change: L478Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130343
Gene: ENSMUSG00000036913
AA Change: L478Q

DomainStartEndE-ValueType
RING 7 157 1.41e-4 SMART
BBOX 198 248 4.65e-5 SMART
BBOX 285 327 3.04e-9 SMART
BBC 334 460 1.18e-28 SMART
FN3 498 579 1.75e-6 SMART
Pfam:SPRY 633 756 3.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211867
AA Change: L478Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,860,719 H142L possibly damaging Het
Abca13 A G 11: 9,290,678 E847G probably benign Het
Abca9 T A 11: 110,115,452 T1276S probably benign Het
Abcb11 C T 2: 69,287,594 probably null Het
AF366264 A T 8: 13,837,995 I32K probably benign Het
Alpk1 G C 3: 127,680,967 H462Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atm C T 9: 53,445,507 V2815M probably benign Het
Braf T C 6: 39,623,641 I681V possibly damaging Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Crybg1 T C 10: 43,998,835 D759G probably damaging Het
Csrp2 A G 10: 110,937,763 N103S probably benign Het
Faf1 A T 4: 109,861,837 H380L probably damaging Het
Farp1 G A 14: 121,276,922 A888T probably benign Het
Fat4 A T 3: 38,981,160 Q2987L probably benign Het
Fkbp15 T A 4: 62,314,341 T665S probably benign Het
Gigyf1 T C 5: 137,520,969 S343P probably benign Het
Glrx3 A G 7: 137,459,225 Y196C probably damaging Het
Gm3278 T G 14: 4,893,349 L66R probably damaging Het
Gm8298 A G 3: 59,865,268 I64M probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 A G 1: 174,028,248 V72A probably benign Het
Ift140 T G 17: 25,051,824 L708R probably damaging Het
Ints13 A T 6: 146,557,338 L328M probably benign Het
Itfg2 A G 6: 128,424,746 I23T probably damaging Het
Ldha C T 7: 46,850,257 P100S unknown Het
Lmtk2 T A 5: 144,148,340 L210H probably damaging Het
Lrrc4 T A 6: 28,829,817 I600L probably benign Het
Map2 C A 1: 66,414,377 P809T probably damaging Het
Matn2 A G 15: 34,402,946 K439R probably benign Het
Matn2 T A 15: 34,423,728 C577* probably null Het
Mep1a C T 17: 43,478,977 G494S probably benign Het
Mtmr4 T C 11: 87,604,580 F488L probably damaging Het
Mtus1 G T 8: 41,016,211 T8K probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mybpc1 T C 10: 88,548,854 T523A possibly damaging Het
Ncoa3 C T 2: 166,069,321 P1334S probably benign Het
Neb T G 2: 52,249,439 M119L Het
Nox4 T C 7: 87,370,022 Y408H probably damaging Het
Nxpe3 C T 16: 55,844,327 R510Q probably damaging Het
Olfr1077-ps1 A T 2: 86,525,830 S116T possibly damaging Het
Olfr1275 C T 2: 111,231,615 M59I probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr484 A G 7: 108,124,834 V143A probably benign Het
Olfr807 C A 10: 129,754,563 E296* probably null Het
Olfr839-ps1 T C 9: 19,175,508 H56R probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pax8 T C 2: 24,436,561 Y263C probably benign Het
Pcdha11 T A 18: 37,005,851 Y178N probably benign Het
Pcdhga11 C T 18: 37,757,130 T397M possibly damaging Het
Pdlim5 G T 3: 142,259,185 H428N probably damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Rgs3 A G 4: 62,701,112 D478G possibly damaging Het
Scgb2b11 C T 7: 32,210,458 E68K probably damaging Het
Sema4b C A 7: 80,220,247 Q428K probably benign Het
Serpine2 T C 1: 79,802,905 T276A probably benign Het
Sgo2b G A 8: 63,940,074 H110Y probably benign Het
Slc12a7 T C 13: 73,806,089 L833S probably benign Het
Slc6a15 T A 10: 103,393,380 probably null Het
Srfbp1 G A 18: 52,475,599 V24I probably damaging Het
Stpg2 A T 3: 139,701,697 N537Y probably damaging Het
Svep1 A T 4: 58,087,782 S1766T probably benign Het
Tiam2 T A 17: 3,482,605 M1K probably null Het
Tmem245 A T 4: 56,899,170 I661K possibly damaging Het
Trim5 T C 7: 104,279,362 H124R probably damaging Het
Triml2 A G 8: 43,193,320 D282G probably damaging Het
Txndc11 T C 16: 11,087,929 Y579C probably damaging Het
Ube3c T A 5: 29,619,631 D551E probably damaging Het
Vmn1r194 T C 13: 22,244,597 V128A not run Het
Vmn2r70 T G 7: 85,568,922 N56T probably damaging Het
Vmn2r-ps130 T A 17: 23,077,032 D725E probably damaging Het
Wdr95 T C 5: 149,594,480 V501A possibly damaging Het
Zc3h8 T C 2: 128,930,822 T249A probably damaging Het
Zfp54 T C 17: 21,434,239 C332R probably damaging Het
Other mutations in Trim67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Trim67 APN 8 124815060 splice site probably benign
IGL01676:Trim67 APN 8 124815160 missense possibly damaging 0.51
IGL01779:Trim67 APN 8 124828121 missense probably damaging 1.00
IGL02057:Trim67 APN 8 124823130 missense probably benign 0.00
IGL02201:Trim67 APN 8 124794058 missense probably benign 0.26
IGL02304:Trim67 APN 8 124825952 missense probably damaging 1.00
R0068:Trim67 UTSW 8 124794568 missense probably damaging 0.97
R0241:Trim67 UTSW 8 124823190 missense probably damaging 0.99
R0319:Trim67 UTSW 8 124823227 missense probably damaging 0.98
R0471:Trim67 UTSW 8 124794658 missense probably benign 0.01
R1171:Trim67 UTSW 8 124829081 missense probably damaging 0.97
R1175:Trim67 UTSW 8 124817035 missense probably damaging 0.99
R1444:Trim67 UTSW 8 124823193 missense probably benign 0.01
R1596:Trim67 UTSW 8 124826139 missense probably damaging 0.97
R1706:Trim67 UTSW 8 124794421 missense probably damaging 1.00
R4951:Trim67 UTSW 8 124794667 missense probably benign
R5200:Trim67 UTSW 8 124824850 missense probably damaging 0.99
R5787:Trim67 UTSW 8 124794312 nonsense probably null
R6023:Trim67 UTSW 8 124815104 missense probably damaging 0.99
R6290:Trim67 UTSW 8 124823179 missense probably benign 0.00
R6536:Trim67 UTSW 8 124794342 missense possibly damaging 0.51
R7315:Trim67 UTSW 8 124794330 missense probably benign 0.18
R8432:Trim67 UTSW 8 124794062 small deletion probably benign
R8446:Trim67 UTSW 8 124793991 missense probably damaging 0.99
R8713:Trim67 UTSW 8 124820335 missense probably null 0.06
Z1088:Trim67 UTSW 8 124817041 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGACAAAGCTGAGCCCTTC -3'
(R):5'- AAAGGCAGCTCAAGTTCAGC -3'

Sequencing Primer
(F):5'- TTCCCCAAAAAGGCTGGCAG -3'
(R):5'- GGTTAGGACCTAGGATCCTTATCC -3'
Posted On2019-11-12