Incidental Mutation 'R7660:Atm'
ID591518
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Nameataxia telangiectasia mutated
SynonymsC030026E19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R7660 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location53439149-53536740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53445507 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 2815 (V2815M)
Ref Sequence ENSEMBL: ENSMUSP00000113388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
Predicted Effect probably benign
Transcript: ENSMUST00000118282
AA Change: V2815M

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: V2815M

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118199
Gene: ENSMUSG00000034218
AA Change: V157M

DomainStartEndE-ValueType
PI3Kc 68 201 5.38e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232179
AA Change: V2818M

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,860,719 H142L possibly damaging Het
Abca13 A G 11: 9,290,678 E847G probably benign Het
Abca9 T A 11: 110,115,452 T1276S probably benign Het
Abcb11 C T 2: 69,287,594 probably null Het
AF366264 A T 8: 13,837,995 I32K probably benign Het
Alpk1 G C 3: 127,680,967 H462Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Braf T C 6: 39,623,641 I681V possibly damaging Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Crybg1 T C 10: 43,998,835 D759G probably damaging Het
Csrp2 A G 10: 110,937,763 N103S probably benign Het
Faf1 A T 4: 109,861,837 H380L probably damaging Het
Farp1 G A 14: 121,276,922 A888T probably benign Het
Fat4 A T 3: 38,981,160 Q2987L probably benign Het
Fkbp15 T A 4: 62,314,341 T665S probably benign Het
Gigyf1 T C 5: 137,520,969 S343P probably benign Het
Glrx3 A G 7: 137,459,225 Y196C probably damaging Het
Gm3278 T G 14: 4,893,349 L66R probably damaging Het
Gm8298 A G 3: 59,865,268 I64M probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 A G 1: 174,028,248 V72A probably benign Het
Ift140 T G 17: 25,051,824 L708R probably damaging Het
Ints13 A T 6: 146,557,338 L328M probably benign Het
Itfg2 A G 6: 128,424,746 I23T probably damaging Het
Ldha C T 7: 46,850,257 P100S unknown Het
Lmtk2 T A 5: 144,148,340 L210H probably damaging Het
Lrrc4 T A 6: 28,829,817 I600L probably benign Het
Map2 C A 1: 66,414,377 P809T probably damaging Het
Matn2 A G 15: 34,402,946 K439R probably benign Het
Matn2 T A 15: 34,423,728 C577* probably null Het
Mep1a C T 17: 43,478,977 G494S probably benign Het
Mtmr4 T C 11: 87,604,580 F488L probably damaging Het
Mtus1 G T 8: 41,016,211 T8K probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mybpc1 T C 10: 88,548,854 T523A possibly damaging Het
Ncoa3 C T 2: 166,069,321 P1334S probably benign Het
Neb T G 2: 52,249,439 M119L Het
Nox4 T C 7: 87,370,022 Y408H probably damaging Het
Nxpe3 C T 16: 55,844,327 R510Q probably damaging Het
Olfr1077-ps1 A T 2: 86,525,830 S116T possibly damaging Het
Olfr1275 C T 2: 111,231,615 M59I probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr484 A G 7: 108,124,834 V143A probably benign Het
Olfr807 C A 10: 129,754,563 E296* probably null Het
Olfr839-ps1 T C 9: 19,175,508 H56R probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pax8 T C 2: 24,436,561 Y263C probably benign Het
Pcdha11 T A 18: 37,005,851 Y178N probably benign Het
Pcdhga11 C T 18: 37,757,130 T397M possibly damaging Het
Pdlim5 G T 3: 142,259,185 H428N probably damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Rgs3 A G 4: 62,701,112 D478G possibly damaging Het
Scgb2b11 C T 7: 32,210,458 E68K probably damaging Het
Sema4b C A 7: 80,220,247 Q428K probably benign Het
Serpine2 T C 1: 79,802,905 T276A probably benign Het
Sgo2b G A 8: 63,940,074 H110Y probably benign Het
Slc12a7 T C 13: 73,806,089 L833S probably benign Het
Slc6a15 T A 10: 103,393,380 probably null Het
Srfbp1 G A 18: 52,475,599 V24I probably damaging Het
Stpg2 A T 3: 139,701,697 N537Y probably damaging Het
Svep1 A T 4: 58,087,782 S1766T probably benign Het
Tiam2 T A 17: 3,482,605 M1K probably null Het
Tmem245 A T 4: 56,899,170 I661K possibly damaging Het
Trim5 T C 7: 104,279,362 H124R probably damaging Het
Trim67 T A 8: 124,820,285 L478Q probably damaging Het
Triml2 A G 8: 43,193,320 D282G probably damaging Het
Txndc11 T C 16: 11,087,929 Y579C probably damaging Het
Ube3c T A 5: 29,619,631 D551E probably damaging Het
Vmn1r194 T C 13: 22,244,597 V128A not run Het
Vmn2r70 T G 7: 85,568,922 N56T probably damaging Het
Vmn2r-ps130 T A 17: 23,077,032 D725E probably damaging Het
Wdr95 T C 5: 149,594,480 V501A possibly damaging Het
Zc3h8 T C 2: 128,930,822 T249A probably damaging Het
Zfp54 T C 17: 21,434,239 C332R probably damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 unclassified probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
Civil UTSW 9 53492268 missense possibly damaging 0.78
Grant UTSW 9 53511917 nonsense probably null
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
osphere UTSW 9 53479673 missense probably damaging 0.99
shiloh UTSW 9 53465298 missense probably damaging 1.00
Strato UTSW 9 53503018 missense probably damaging 1.00
tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 intron probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
R7208:Atm UTSW 9 53512008 intron probably null
R7211:Atm UTSW 9 53488560 missense probably benign 0.01
R7220:Atm UTSW 9 53511917 nonsense probably null
R7336:Atm UTSW 9 53462503 missense possibly damaging 0.47
R7363:Atm UTSW 9 53465298 missense probably damaging 1.00
R7378:Atm UTSW 9 53453437 critical splice acceptor site probably null
R7472:Atm UTSW 9 53448125 missense possibly damaging 0.81
R7487:Atm UTSW 9 53524354 missense probably benign
R7497:Atm UTSW 9 53511891 missense probably benign 0.00
R7584:Atm UTSW 9 53513127 missense probably damaging 0.99
R7624:Atm UTSW 9 53454768 missense probably damaging 0.99
R7653:Atm UTSW 9 53490302 nonsense probably null
R7679:Atm UTSW 9 53442497 missense probably damaging 1.00
R7720:Atm UTSW 9 53522239 missense possibly damaging 0.54
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCTTGTGAGACAGAAGCAG -3'
(R):5'- TCCTCAGTCGATTATCACTTGG -3'

Sequencing Primer
(F):5'- CTCCTTGTGAGACAGAAGCAGTAATG -3'
(R):5'- ACTTGGATTAATGGTTTTCCTGACC -3'
Posted On2019-11-12