Mutagenetix > Incidental Mutation

Incidental Mutation 'R7660:Mybpc1'

591521

Institutional Source

Beutler Lab

Gene Symbol

Mybpc1

Ensembl Gene

ENSMUSG00000020061

Gene Name

myosin binding protein C, slow-type

Synonyms

8030451F13Rik, Slow-type C-protein

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.777) question?

Stock #

R7660 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88518279-88605152 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 88548854 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 523 (T523A)

Ref Sequence

ENSEMBL: ENSMUSP00000112699 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000119185] [ENSMUST00000121629]

AlphaFold

A0A571BEN1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119185
AA Change: T523A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112699
Gene: ENSMUSG00000020061
AA Change: T523A

Domain	Start	End	E-Value	Type
IG	51	147	1.96e-6	SMART
low complexity region	221	233	N/A	INTRINSIC
IG	246	325	4.53e-2	SMART
IG	335	416	1.13e-2	SMART
IG	426	506	6.97e-3	SMART
IG	519	604	2.83e-3	SMART
FN3	607	690	4.28e-10	SMART
FN3	705	788	1.49e-9	SMART
low complexity region	800	812	N/A	INTRINSIC
IG	815	898	9.06e-2	SMART
FN3	901	983	2.06e-12	SMART
IGc2	1028	1095	1.88e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121629
AA Change: T537A

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112615
Gene: ENSMUSG00000020061
AA Change: T537A

Domain	Start	End	E-Value	Type
low complexity region	8	27	N/A	INTRINSIC
IG	65	161	1.96e-6	SMART
low complexity region	235	247	N/A	INTRINSIC
IG	260	339	4.53e-2	SMART
IG	349	430	1.13e-2	SMART
IG	440	520	6.97e-3	SMART
IG	533	618	2.83e-3	SMART
FN3	621	704	4.28e-10	SMART
FN3	719	802	1.49e-9	SMART
low complexity region	814	826	N/A	INTRINSIC
IG	829	912	9.06e-2	SMART
FN3	915	997	2.06e-12	SMART
IGc2	1042	1109	1.88e-8	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000119024
Gene: ENSMUSG00000020061
AA Change: T162A

Domain	Start	End	E-Value	Type
PDB:1X44\|A	2	58	1e-26	PDB
IG	66	146	6.97e-3	SMART
IG	159	244	2.83e-3	SMART
FN3	247	330	4.28e-10	SMART
FN3	345	446	1.6e-9	SMART
low complexity region	458	470	N/A	INTRINSIC
IG	473	556	9.06e-2	SMART
FN3	559	617	8.17e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.3%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin-binding protein C family. Myosin-binding protein C family members are myosin-associated proteins found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. The encoded protein is the slow skeletal muscle isoform of myosin-binding protein C and plays an important role in muscle contraction by recruiting muscle-type creatine kinase to myosin filaments. Mutations in this gene are associated with distal arthrogryposis type I. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427I04Rik	A	T	4: 123,860,719	H142L	possibly damaging	Het
Abca13	A	G	11: 9,290,678	E847G	probably benign	Het
Abca9	T	A	11: 110,115,452	T1276S	probably benign	Het
Abcb11	C	T	2: 69,287,594		probably null	Het
AF366264	A	T	8: 13,837,995	I32K	probably benign	Het
Alpk1	G	C	3: 127,680,967	H462Q	probably damaging	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atm	C	T	9: 53,445,507	V2815M	probably benign	Het
Braf	T	C	6: 39,623,641	I681V	possibly damaging	Het
Casc3	C	G	11: 98,809,873	R4G	unknown	Het
Crybg1	T	C	10: 43,998,835	D759G	probably damaging	Het
Csrp2	A	G	10: 110,937,763	N103S	probably benign	Het
Faf1	A	T	4: 109,861,837	H380L	probably damaging	Het
Farp1	G	A	14: 121,276,922	A888T	probably benign	Het
Fat4	A	T	3: 38,981,160	Q2987L	probably benign	Het
Fkbp15	T	A	4: 62,314,341	T665S	probably benign	Het
Gigyf1	T	C	5: 137,520,969	S343P	probably benign	Het
Glrx3	A	G	7: 137,459,225	Y196C	probably damaging	Het
Gm3278	T	G	14: 4,893,349	L66R	probably damaging	Het
Gm8298	A	G	3: 59,865,268	I64M	probably benign	Het
Ick	G	C	9: 78,167,620	V586L	probably benign	Het
Ifi205	A	G	1: 174,028,248	V72A	probably benign	Het
Ift140	T	G	17: 25,051,824	L708R	probably damaging	Het
Ints13	A	T	6: 146,557,338	L328M	probably benign	Het
Itfg2	A	G	6: 128,424,746	I23T	probably damaging	Het
Ldha	C	T	7: 46,850,257	P100S	unknown	Het
Lmtk2	T	A	5: 144,148,340	L210H	probably damaging	Het
Lrrc4	T	A	6: 28,829,817	I600L	probably benign	Het
Map2	C	A	1: 66,414,377	P809T	probably damaging	Het
Matn2	A	G	15: 34,402,946	K439R	probably benign	Het
Matn2	T	A	15: 34,423,728	C577*	probably null	Het
Mep1a	C	T	17: 43,478,977	G494S	probably benign	Het
Mtmr4	T	C	11: 87,604,580	F488L	probably damaging	Het
Mtus1	G	T	8: 41,016,211	T8K	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Ncoa3	C	T	2: 166,069,321	P1334S	probably benign	Het
Neb	T	G	2: 52,249,439	M119L		Het
Nox4	T	C	7: 87,370,022	Y408H	probably damaging	Het
Nxpe3	C	T	16: 55,844,327	R510Q	probably damaging	Het
Olfr1077-ps1	A	T	2: 86,525,830	S116T	possibly damaging	Het
Olfr1275	C	T	2: 111,231,615	M59I	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr484	A	G	7: 108,124,834	V143A	probably benign	Het
Olfr807	C	A	10: 129,754,563	E296*	probably null	Het
Olfr839-ps1	T	C	9: 19,175,508	H56R	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pax8	T	C	2: 24,436,561	Y263C	probably benign	Het
Pcdha11	T	A	18: 37,005,851	Y178N	probably benign	Het
Pcdhga11	C	T	18: 37,757,130	T397M	possibly damaging	Het
Pdlim5	G	T	3: 142,259,185	H428N	probably damaging	Het
Pigg	G	A	5: 108,338,619	V713I	probably benign	Het
Rgs3	A	G	4: 62,701,112	D478G	possibly damaging	Het
Scgb2b11	C	T	7: 32,210,458	E68K	probably damaging	Het
Sema4b	C	A	7: 80,220,247	Q428K	probably benign	Het
Serpine2	T	C	1: 79,802,905	T276A	probably benign	Het
Sgo2b	G	A	8: 63,940,074	H110Y	probably benign	Het
Slc12a7	T	C	13: 73,806,089	L833S	probably benign	Het
Slc6a15	T	A	10: 103,393,380		probably null	Het
Srfbp1	G	A	18: 52,475,599	V24I	probably damaging	Het
Stpg2	A	T	3: 139,701,697	N537Y	probably damaging	Het
Svep1	A	T	4: 58,087,782	S1766T	probably benign	Het
Tiam2	T	A	17: 3,482,605	M1K	probably null	Het
Tmem245	A	T	4: 56,899,170	I661K	possibly damaging	Het
Trim5	T	C	7: 104,279,362	H124R	probably damaging	Het
Trim67	T	A	8: 124,820,285	L478Q	probably damaging	Het
Triml2	A	G	8: 43,193,320	D282G	probably damaging	Het
Txndc11	T	C	16: 11,087,929	Y579C	probably damaging	Het
Ube3c	T	A	5: 29,619,631	D551E	probably damaging	Het
Vmn1r194	T	C	13: 22,244,597	V128A	not run	Het
Vmn2r70	T	G	7: 85,568,922	N56T	probably damaging	Het
Vmn2r-ps130	T	A	17: 23,077,032	D725E	probably damaging	Het
Wdr95	T	C	5: 149,594,480	V501A	possibly damaging	Het
Zc3h8	T	C	2: 128,930,822	T249A	probably damaging	Het
Zfp54	T	C	17: 21,434,239	C332R	probably damaging	Het

Other mutations in Mybpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00468:Mybpc1	APN	10	88549262	missense	probably damaging	0.98
IGL00577:Mybpc1	APN	10	88536384	missense	probably damaging	1.00
IGL00703:Mybpc1	APN	10	88525108	splice site	probably null
IGL00964:Mybpc1	APN	10	88555742	critical splice acceptor site	probably null
IGL01738:Mybpc1	APN	10	88570645	missense	probably damaging	1.00
IGL01978:Mybpc1	APN	10	88531770	missense	probably damaging	1.00
IGL02255:Mybpc1	APN	10	88536428	missense	probably damaging	1.00
IGL02997:Mybpc1	APN	10	88526373	missense	probably damaging	1.00
R0098:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0240:Mybpc1	UTSW	10	88555738	missense	possibly damaging	0.59
R0449:Mybpc1	UTSW	10	88540960	missense	probably damaging	1.00
R0879:Mybpc1	UTSW	10	88571516	splice site	probably benign
R1321:Mybpc1	UTSW	10	88529541	missense	possibly damaging	0.85
R1321:Mybpc1	UTSW	10	88570601	missense	probably damaging	1.00
R1562:Mybpc1	UTSW	10	88553331	missense	probably damaging	1.00
R1783:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R1803:Mybpc1	UTSW	10	88553295	missense	possibly damaging	0.65
R1962:Mybpc1	UTSW	10	88548826	missense	probably damaging	1.00
R1972:Mybpc1	UTSW	10	88551542	missense	probably benign	0.00
R2006:Mybpc1	UTSW	10	88546059	missense	probably damaging	0.99
R2125:Mybpc1	UTSW	10	88573437	nonsense	probably null
R2129:Mybpc1	UTSW	10	88551452	missense	probably damaging	1.00
R2163:Mybpc1	UTSW	10	88540942	splice site	probably benign
R2200:Mybpc1	UTSW	10	88555695	missense	probably damaging	1.00
R2219:Mybpc1	UTSW	10	88555678	missense	probably damaging	1.00
R2270:Mybpc1	UTSW	10	88551407	missense	probably benign	0.01
R2961:Mybpc1	UTSW	10	88531779	missense	probably damaging	1.00
R3767:Mybpc1	UTSW	10	88570659	splice site	probably null
R4032:Mybpc1	UTSW	10	88529564	missense	probably benign	0.02
R4226:Mybpc1	UTSW	10	88573525	nonsense	probably null
R4821:Mybpc1	UTSW	10	88548865	missense	probably damaging	0.98
R4876:Mybpc1	UTSW	10	88522991	missense	probably benign
R4876:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R4878:Mybpc1	UTSW	10	88551430	missense	possibly damaging	0.95
R4910:Mybpc1	UTSW	10	88555724	nonsense	probably null
R4913:Mybpc1	UTSW	10	88553254	critical splice donor site	probably null
R4964:Mybpc1	UTSW	10	88555663	missense	probably benign	0.31
R5023:Mybpc1	UTSW	10	88543774	missense	probably damaging	1.00
R5098:Mybpc1	UTSW	10	88546064	missense	probably damaging	1.00
R5196:Mybpc1	UTSW	10	88536351	missense	probably damaging	0.97
R5344:Mybpc1	UTSW	10	88570568	missense	probably damaging	1.00
R5399:Mybpc1	UTSW	10	88523014	missense	probably damaging	1.00
R5538:Mybpc1	UTSW	10	88546029	missense	possibly damaging	0.89
R5808:Mybpc1	UTSW	10	88570566	missense	possibly damaging	0.83
R5970:Mybpc1	UTSW	10	88542456	missense	probably damaging	1.00
R6324:Mybpc1	UTSW	10	88568619	missense	possibly damaging	0.56
R6433:Mybpc1	UTSW	10	88560355	missense	probably damaging	1.00
R6441:Mybpc1	UTSW	10	88553277	missense	probably benign	0.09
R6648:Mybpc1	UTSW	10	88522999	missense	probably damaging	0.96
R6844:Mybpc1	UTSW	10	88536381	missense	possibly damaging	0.50
R6931:Mybpc1	UTSW	10	88542330	nonsense	probably null
R6972:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6973:Mybpc1	UTSW	10	88560361	missense	possibly damaging	0.50
R6978:Mybpc1	UTSW	10	88523024	missense	probably damaging	1.00
R7007:Mybpc1	UTSW	10	88553412	missense	probably damaging	1.00
R7019:Mybpc1	UTSW	10	88543719	missense	probably damaging	1.00
R7407:Mybpc1	UTSW	10	88549347	missense	probably damaging	0.99
R7442:Mybpc1	UTSW	10	88526293	missense	probably damaging	1.00
R7577:Mybpc1	UTSW	10	88549325	missense	probably damaging	1.00
R7768:Mybpc1	UTSW	10	88542372	missense	probably damaging	1.00
R7818:Mybpc1	UTSW	10	88558667	missense	probably damaging	1.00
R8171:Mybpc1	UTSW	10	88523003	missense	probably damaging	1.00
R8195:Mybpc1	UTSW	10	88558691	missense	possibly damaging	0.47
R8241:Mybpc1	UTSW	10	88536424	missense	probably benign	0.03
R8360:Mybpc1	UTSW	10	88573497	nonsense	probably null
R8494:Mybpc1	UTSW	10	88526429	missense	probably benign	0.01
R8849:Mybpc1	UTSW	10	88571585	missense	probably benign	0.01
R8936:Mybpc1	UTSW	10	88558575	missense	probably benign	0.44
R9031:Mybpc1	UTSW	10	88523044	missense	probably damaging	0.99
R9061:Mybpc1	UTSW	10	88555639	missense	probably damaging	1.00
R9081:Mybpc1	UTSW	10	88553306	missense	probably damaging	1.00
R9172:Mybpc1	UTSW	10	88543753	missense	possibly damaging	0.93
R9323:Mybpc1	UTSW	10	88524967	critical splice donor site	probably null
R9460:Mybpc1	UTSW	10	88536335	missense	probably damaging	0.99
R9488:Mybpc1	UTSW	10	88543762	missense	possibly damaging	0.47
R9757:Mybpc1	UTSW	10	88536395	missense	probably damaging	1.00
R9796:Mybpc1	UTSW	10	88570635	missense	possibly damaging	0.56
Z1176:Mybpc1	UTSW	10	88560327	missense	probably benign
Z1177:Mybpc1	UTSW	10	88573437	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATCACAGGGTCAGGTCATGTG -3'
(R):5'- ACCAACTGCCATGATGACTC -3'

Sequencing Primer
(F):5'- TCAGGTCATGTGCATGCAC -3'
(R):5'- GATGACTCATGACTCATATGTGTG -3'

Posted On

2019-11-12