Mutagenetix > Incidental Mutation

Incidental Mutation 'R7660:Abca9'

591527

Institutional Source

Beutler Lab

Gene Symbol

Abca9

Ensembl Gene

ENSMUSG00000041797

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 9

Synonyms

D630040K07Rik

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_147220.2; MGI: 2386796

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7660 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110100749-110168196 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 110115452 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1276 (T1276S)

Ref Sequence

ENSEMBL: ENSMUSP00000036338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044850]

AlphaFold

Q8K449

Predicted Effect

probably benign
Transcript: ENSMUST00000044850
AA Change: T1276S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000036338
Gene: ENSMUSG00000041797
AA Change: T1276S

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	419	2.7e-31	PFAM
AAA	509	693	9.28e-12	SMART
low complexity region	817	837	N/A	INTRINSIC
transmembrane domain	862	884	N/A	INTRINSIC
Pfam:ABC2_membrane_3	918	1219	5.2e-15	PFAM
low complexity region	1250	1259	N/A	INTRINSIC
AAA	1317	1497	8.47e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.3%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two transmembrane domains and two nucleotide binding folds. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This gene is a member of the ABC1 subfamily and is clustered with four other ABC1 family members on chromosome 17q24. Transcriptional expression of this gene is induced during monocyte differentiation into macrophages and is suppressed by cholesterol import. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427I04Rik	A	T	4: 123,860,719	H142L	possibly damaging	Het
Abca13	A	G	11: 9,290,678	E847G	probably benign	Het
Abcb11	C	T	2: 69,287,594		probably null	Het
AF366264	A	T	8: 13,837,995	I32K	probably benign	Het
Alpk1	G	C	3: 127,680,967	H462Q	probably damaging	Het
Armh1	C	A	4: 117,213,741	A396S	probably benign	Het
Atm	C	T	9: 53,445,507	V2815M	probably benign	Het
Braf	T	C	6: 39,623,641	I681V	possibly damaging	Het
Casc3	C	G	11: 98,809,873	R4G	unknown	Het
Crybg1	T	C	10: 43,998,835	D759G	probably damaging	Het
Csrp2	A	G	10: 110,937,763	N103S	probably benign	Het
Faf1	A	T	4: 109,861,837	H380L	probably damaging	Het
Farp1	G	A	14: 121,276,922	A888T	probably benign	Het
Fat4	A	T	3: 38,981,160	Q2987L	probably benign	Het
Fkbp15	T	A	4: 62,314,341	T665S	probably benign	Het
Gigyf1	T	C	5: 137,520,969	S343P	probably benign	Het
Glrx3	A	G	7: 137,459,225	Y196C	probably damaging	Het
Gm3278	T	G	14: 4,893,349	L66R	probably damaging	Het
Gm8298	A	G	3: 59,865,268	I64M	probably benign	Het
Ick	G	C	9: 78,167,620	V586L	probably benign	Het
Ifi205	A	G	1: 174,028,248	V72A	probably benign	Het
Ift140	T	G	17: 25,051,824	L708R	probably damaging	Het
Ints13	A	T	6: 146,557,338	L328M	probably benign	Het
Itfg2	A	G	6: 128,424,746	I23T	probably damaging	Het
Ldha	C	T	7: 46,850,257	P100S	unknown	Het
Lmtk2	T	A	5: 144,148,340	L210H	probably damaging	Het
Lrrc4	T	A	6: 28,829,817	I600L	probably benign	Het
Map2	C	A	1: 66,414,377	P809T	probably damaging	Het
Matn2	A	G	15: 34,402,946	K439R	probably benign	Het
Matn2	T	A	15: 34,423,728	C577*	probably null	Het
Mep1a	C	T	17: 43,478,977	G494S	probably benign	Het
Mtmr4	T	C	11: 87,604,580	F488L	probably damaging	Het
Mtus1	G	T	8: 41,016,211	T8K	probably benign	Het
Mug1	C	A	6: 121,861,220	H470N	possibly damaging	Het
Mybpc1	T	C	10: 88,548,854	T523A	possibly damaging	Het
Ncoa3	C	T	2: 166,069,321	P1334S	probably benign	Het
Neb	T	G	2: 52,249,439	M119L		Het
Nox4	T	C	7: 87,370,022	Y408H	probably damaging	Het
Nxpe3	C	T	16: 55,844,327	R510Q	probably damaging	Het
Olfr1077-ps1	A	T	2: 86,525,830	S116T	possibly damaging	Het
Olfr1275	C	T	2: 111,231,615	M59I	probably damaging	Het
Olfr48	T	C	2: 89,844,443	T177A	probably benign	Het
Olfr484	A	G	7: 108,124,834	V143A	probably benign	Het
Olfr807	C	A	10: 129,754,563	E296*	probably null	Het
Olfr839-ps1	T	C	9: 19,175,508	H56R	probably benign	Het
Paip1	C	T	13: 119,450,770	T390I	possibly damaging	Het
Pax8	T	C	2: 24,436,561	Y263C	probably benign	Het
Pcdha11	T	A	18: 37,005,851	Y178N	probably benign	Het
Pcdhga11	C	T	18: 37,757,130	T397M	possibly damaging	Het
Pdlim5	G	T	3: 142,259,185	H428N	probably damaging	Het
Pigg	G	A	5: 108,338,619	V713I	probably benign	Het
Rgs3	A	G	4: 62,701,112	D478G	possibly damaging	Het
Scgb2b11	C	T	7: 32,210,458	E68K	probably damaging	Het
Sema4b	C	A	7: 80,220,247	Q428K	probably benign	Het
Serpine2	T	C	1: 79,802,905	T276A	probably benign	Het
Sgo2b	G	A	8: 63,940,074	H110Y	probably benign	Het
Slc12a7	T	C	13: 73,806,089	L833S	probably benign	Het
Slc6a15	T	A	10: 103,393,380		probably null	Het
Srfbp1	G	A	18: 52,475,599	V24I	probably damaging	Het
Stpg2	A	T	3: 139,701,697	N537Y	probably damaging	Het
Svep1	A	T	4: 58,087,782	S1766T	probably benign	Het
Tiam2	T	A	17: 3,482,605	M1K	probably null	Het
Tmem245	A	T	4: 56,899,170	I661K	possibly damaging	Het
Trim5	T	C	7: 104,279,362	H124R	probably damaging	Het
Trim67	T	A	8: 124,820,285	L478Q	probably damaging	Het
Triml2	A	G	8: 43,193,320	D282G	probably damaging	Het
Txndc11	T	C	16: 11,087,929	Y579C	probably damaging	Het
Ube3c	T	A	5: 29,619,631	D551E	probably damaging	Het
Vmn1r194	T	C	13: 22,244,597	V128A	not run	Het
Vmn2r70	T	G	7: 85,568,922	N56T	probably damaging	Het
Vmn2r-ps130	T	A	17: 23,077,032	D725E	probably damaging	Het
Wdr95	T	C	5: 149,594,480	V501A	possibly damaging	Het
Zc3h8	T	C	2: 128,930,822	T249A	probably damaging	Het
Zfp54	T	C	17: 21,434,239	C332R	probably damaging	Het

Other mutations in Abca9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00309:Abca9	APN	11	110160516	missense	probably benign
IGL00467:Abca9	APN	11	110145670	splice site	probably benign
IGL00886:Abca9	APN	11	110163275	missense	possibly damaging	0.93
IGL01340:Abca9	APN	11	110130627	missense	probably benign
IGL01351:Abca9	APN	11	110148903	missense	probably damaging	0.99
IGL01383:Abca9	APN	11	110113293	splice site	probably benign
IGL01384:Abca9	APN	11	110145637	missense	probably damaging	1.00
IGL01482:Abca9	APN	11	110120773	missense	probably benign	0.05
IGL01586:Abca9	APN	11	110154417	missense	probably damaging	0.99
IGL01589:Abca9	APN	11	110155177	missense	probably damaging	1.00
IGL01926:Abca9	APN	11	110135329	splice site	probably benign
IGL02059:Abca9	APN	11	110160394	splice site	probably benign
IGL02084:Abca9	APN	11	110130597	missense	probably benign
IGL02096:Abca9	APN	11	110102533	missense	probably damaging	1.00
IGL02096:Abca9	APN	11	110165980	missense	probably benign	0.01
IGL02290:Abca9	APN	11	110135351	missense	probably damaging	1.00
IGL02303:Abca9	APN	11	110154550	missense	probably damaging	1.00
IGL02549:Abca9	APN	11	110102053	missense	probably damaging	1.00
IGL02687:Abca9	APN	11	110114232	missense	probably damaging	1.00
IGL02752:Abca9	APN	11	110127368	missense	probably damaging	1.00
IGL02814:Abca9	APN	11	110154467	missense	possibly damaging	0.90
IGL02878:Abca9	APN	11	110138329	missense	probably benign	0.01
IGL03088:Abca9	APN	11	110144261	missense	probably benign	0.06
IGL03231:Abca9	APN	11	110155268	missense	probably damaging	0.96
R0050:Abca9	UTSW	11	110145591	missense	probably damaging	1.00
R0050:Abca9	UTSW	11	110145591	missense	probably damaging	1.00
R0064:Abca9	UTSW	11	110144871	missense	probably damaging	1.00
R0064:Abca9	UTSW	11	110144872	missense	probably damaging	1.00
R0068:Abca9	UTSW	11	110145579	missense	probably damaging	0.99
R0189:Abca9	UTSW	11	110108653	missense	probably damaging	1.00
R0189:Abca9	UTSW	11	110141662	splice site	probably benign
R0375:Abca9	UTSW	11	110115447	missense	probably benign	0.00
R0601:Abca9	UTSW	11	110117058	critical splice donor site	probably null
R0624:Abca9	UTSW	11	110139620	missense	probably damaging	1.00
R0652:Abca9	UTSW	11	110152063	missense	probably benign	0.02
R1004:Abca9	UTSW	11	110151954	missense	possibly damaging	0.88
R1222:Abca9	UTSW	11	110145064	splice site	probably benign
R1451:Abca9	UTSW	11	110127447	missense	probably damaging	1.00
R1462:Abca9	UTSW	11	110160516	missense	probably benign
R1462:Abca9	UTSW	11	110160516	missense	probably benign
R1474:Abca9	UTSW	11	110145579	missense	probably damaging	0.99
R1499:Abca9	UTSW	11	110139632	missense	probably benign	0.00
R1778:Abca9	UTSW	11	110130716	nonsense	probably null
R2015:Abca9	UTSW	11	110131846	missense	probably benign	0.01
R2295:Abca9	UTSW	11	110148903	missense	probably damaging	0.99
R2303:Abca9	UTSW	11	110158226	missense	probably benign	0.01
R2403:Abca9	UTSW	11	110115454	missense	probably benign	0.16
R2886:Abca9	UTSW	11	110144886	splice site	probably benign
R3435:Abca9	UTSW	11	110154430	missense	probably benign	0.24
R3976:Abca9	UTSW	11	110148789	missense	probably benign	0.25
R4335:Abca9	UTSW	11	110152017	missense	probably damaging	1.00
R4411:Abca9	UTSW	11	110151955	missense	probably benign	0.00
R4613:Abca9	UTSW	11	110144784	missense	probably benign	0.26
R4690:Abca9	UTSW	11	110148880	missense	probably damaging	1.00
R4720:Abca9	UTSW	11	110127422	missense	probably damaging	1.00
R4751:Abca9	UTSW	11	110130570	missense	probably benign	0.00
R4797:Abca9	UTSW	11	110118119	missense	probably benign
R4818:Abca9	UTSW	11	110155154	critical splice donor site	probably null
R4903:Abca9	UTSW	11	110147001	missense	probably damaging	1.00
R4971:Abca9	UTSW	11	110152048	missense	probably benign	0.43
R4977:Abca9	UTSW	11	110136073	missense	probably benign	0.00
R5019:Abca9	UTSW	11	110165934	missense	probably benign
R5079:Abca9	UTSW	11	110145569	missense	possibly damaging	0.47
R5082:Abca9	UTSW	11	110131868	missense	probably benign
R5093:Abca9	UTSW	11	110141532	missense	probably damaging	0.98
R5212:Abca9	UTSW	11	110107226	missense	probably benign	0.02
R5350:Abca9	UTSW	11	110115538	missense	probably benign
R5368:Abca9	UTSW	11	110145546	missense	probably damaging	1.00
R5432:Abca9	UTSW	11	110141554	missense	possibly damaging	0.83
R5436:Abca9	UTSW	11	110134236	missense	probably damaging	1.00
R5497:Abca9	UTSW	11	110130692	missense	probably damaging	1.00
R5503:Abca9	UTSW	11	110141610	missense	probably damaging	1.00
R5594:Abca9	UTSW	11	110144862	missense	probably damaging	1.00
R5742:Abca9	UTSW	11	110160417	missense	probably damaging	0.98
R5776:Abca9	UTSW	11	110107460	splice site	probably null
R5781:Abca9	UTSW	11	110101987	missense	probably damaging	1.00
R5872:Abca9	UTSW	11	110117076	missense	possibly damaging	0.70
R5923:Abca9	UTSW	11	110160552	missense	probably benign	0.09
R6020:Abca9	UTSW	11	110145613	missense	possibly damaging	0.86
R6179:Abca9	UTSW	11	110134254	missense	probably benign	0.05
R6245:Abca9	UTSW	11	110135423	missense	probably damaging	1.00
R6249:Abca9	UTSW	11	110145627	missense	probably benign
R6365:Abca9	UTSW	11	110145655	missense	possibly damaging	0.63
R6385:Abca9	UTSW	11	110134254	missense	probably damaging	0.99
R6481:Abca9	UTSW	11	110165962	nonsense	probably null
R6675:Abca9	UTSW	11	110115476	missense	probably benign
R6909:Abca9	UTSW	11	110115497	missense	probably benign	0.01
R7390:Abca9	UTSW	11	110145661	missense	probably benign	0.01
R7429:Abca9	UTSW	11	110127426	frame shift	probably null
R7431:Abca9	UTSW	11	110127426	frame shift	probably null
R7621:Abca9	UTSW	11	110160533	missense	probably benign	0.00
R7623:Abca9	UTSW	11	110107558	missense	probably benign	0.27
R7784:Abca9	UTSW	11	110154417	nonsense	probably null
R7798:Abca9	UTSW	11	110138179	missense	probably benign	0.45
R7839:Abca9	UTSW	11	110134259	missense	probably benign	0.43
R7891:Abca9	UTSW	11	110163272	missense	probably benign	0.03
R7894:Abca9	UTSW	11	110106589	missense	possibly damaging	0.49
R8030:Abca9	UTSW	11	110120708	missense	probably benign
R8133:Abca9	UTSW	11	110127463	missense	possibly damaging	0.88
R8195:Abca9	UTSW	11	110138329	missense	probably benign	0.01
R8304:Abca9	UTSW	11	110107128	critical splice donor site	probably null
R8386:Abca9	UTSW	11	110130692	missense	probably damaging	1.00
R8390:Abca9	UTSW	11	110145630	missense	probably benign	0.01
R8692:Abca9	UTSW	11	110141583	missense	probably benign	0.11
R8721:Abca9	UTSW	11	110144289	missense	possibly damaging	0.82
R8738:Abca9	UTSW	11	110165991	start codon destroyed	probably null	1.00
R8900:Abca9	UTSW	11	110154392	missense	probably benign
R8948:Abca9	UTSW	11	110163380	critical splice acceptor site	probably null
R8950:Abca9	UTSW	11	110163380	critical splice acceptor site	probably null
R8964:Abca9	UTSW	11	110147249	nonsense	probably null
R9019:Abca9	UTSW	11	110120696	missense
R9034:Abca9	UTSW	11	110148789	missense	probably benign	0.25
R9035:Abca9	UTSW	11	110130635	missense	probably damaging	0.97
R9086:Abca9	UTSW	11	110102053	missense	probably damaging	1.00
R9199:Abca9	UTSW	11	110165944	missense	possibly damaging	0.49
R9402:Abca9	UTSW	11	110158328	missense	probably benign	0.14
R9414:Abca9	UTSW	11	110144274	missense	probably damaging	0.97
R9554:Abca9	UTSW	11	110138281	missense	probably benign
R9626:Abca9	UTSW	11	110120780	missense	probably benign	0.01
R9651:Abca9	UTSW	11	110115493	missense	probably benign	0.09
R9665:Abca9	UTSW	11	110115454	missense	probably benign
R9665:Abca9	UTSW	11	110115455	missense	probably benign	0.00
R9731:Abca9	UTSW	11	110134198	missense	probably benign
Z1176:Abca9	UTSW	11	110135375	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTGCACTTATCAAAACTATGGCTC -3'
(R):5'- GCAGCATCGTTTGACCAGTTG -3'

Sequencing Primer
(F):5'- AACTGATTGTGTGTGTGTGTGTAGC -3'
(R):5'- AGGGATGAGGGTATTTGAATGGTAC -3'

Posted On

2019-11-12