Incidental Mutation 'R7660:Slc12a7'
ID 591529
Institutional Source Beutler Lab
Gene Symbol Slc12a7
Ensembl Gene ENSMUSG00000017756
Gene Name solute carrier family 12, member 7
Synonyms Kcc4
MMRRC Submission 045735-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7660 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 73881213-73964873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73954208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 833 (L833S)
Ref Sequence ENSEMBL: ENSMUSP00000017900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017900]
AlphaFold Q9WVL3
Predicted Effect probably benign
Transcript: ENSMUST00000017900
AA Change: L833S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017900
Gene: ENSMUSG00000017756
AA Change: L833S

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 99 113 N/A INTRINSIC
Pfam:AA_permease 123 308 1e-22 PFAM
low complexity region 390 407 N/A INTRINSIC
Pfam:AA_permease 410 696 1.5e-40 PFAM
Pfam:SLC12 708 834 4.6e-18 PFAM
Pfam:SLC12 818 1083 2.3e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
MGI Phenotype PHENOTYPE: Hearing is severely impaired in homozygous mutant mice, which also exhibit renal tubular acidosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,754,512 (GRCm39) H142L possibly damaging Het
Aadacl2fm3 A G 3: 59,772,689 (GRCm39) I64M probably benign Het
Abca13 A G 11: 9,240,678 (GRCm39) E847G probably benign Het
Abca9 T A 11: 110,006,278 (GRCm39) T1276S probably benign Het
Abcb11 C T 2: 69,117,938 (GRCm39) probably null Het
Alpk1 G C 3: 127,474,616 (GRCm39) H462Q probably damaging Het
Armh1 C A 4: 117,070,938 (GRCm39) A396S probably benign Het
Atm C T 9: 53,356,807 (GRCm39) V2815M probably benign Het
Braf T C 6: 39,600,575 (GRCm39) I681V possibly damaging Het
Casc3 C G 11: 98,700,699 (GRCm39) R4G unknown Het
Cilk1 G C 9: 78,074,902 (GRCm39) V586L probably benign Het
Crybg1 T C 10: 43,874,831 (GRCm39) D759G probably damaging Het
Csrp2 A G 10: 110,773,624 (GRCm39) N103S probably benign Het
Faf1 A T 4: 109,719,034 (GRCm39) H380L probably damaging Het
Farp1 G A 14: 121,514,334 (GRCm39) A888T probably benign Het
Fat4 A T 3: 39,035,309 (GRCm39) Q2987L probably benign Het
Fkbp15 T A 4: 62,232,578 (GRCm39) T665S probably benign Het
Gigyf1 T C 5: 137,519,231 (GRCm39) S343P probably benign Het
Glrx3 A G 7: 137,060,954 (GRCm39) Y196C probably damaging Het
Gm3278 T G 14: 16,080,387 (GRCm39) L66R probably damaging Het
Ifi205 A G 1: 173,855,814 (GRCm39) V72A probably benign Het
Ift140 T G 17: 25,270,798 (GRCm39) L708R probably damaging Het
Ints13 A T 6: 146,458,836 (GRCm39) L328M probably benign Het
Itfg2 A G 6: 128,401,709 (GRCm39) I23T probably damaging Het
Ldha C T 7: 46,499,681 (GRCm39) P100S unknown Het
Lmtk2 T A 5: 144,085,158 (GRCm39) L210H probably damaging Het
Lrrc4 T A 6: 28,829,816 (GRCm39) I600L probably benign Het
Map2 C A 1: 66,453,536 (GRCm39) P809T probably damaging Het
Matn2 T A 15: 34,423,874 (GRCm39) C577* probably null Het
Matn2 A G 15: 34,403,092 (GRCm39) K439R probably benign Het
Mep1a C T 17: 43,789,868 (GRCm39) G494S probably benign Het
Mtmr4 T C 11: 87,495,406 (GRCm39) F488L probably damaging Het
Mtus1 G T 8: 41,469,248 (GRCm39) T8K probably benign Het
Mug1 C A 6: 121,838,179 (GRCm39) H470N possibly damaging Het
Mybpc1 T C 10: 88,384,716 (GRCm39) T523A possibly damaging Het
Ncoa3 C T 2: 165,911,241 (GRCm39) P1334S probably benign Het
Neb T G 2: 52,139,451 (GRCm39) M119L Het
Nox4 T C 7: 87,019,230 (GRCm39) Y408H probably damaging Het
Nxpe3 C T 16: 55,664,690 (GRCm39) R510Q probably damaging Het
Or4c58 T C 2: 89,674,787 (GRCm39) T177A probably benign Het
Or4f52 C T 2: 111,061,960 (GRCm39) M59I probably damaging Het
Or5p60 A G 7: 107,724,041 (GRCm39) V143A probably benign Het
Or6c214 C A 10: 129,590,432 (GRCm39) E296* probably null Het
Or7g23 T C 9: 19,086,804 (GRCm39) H56R probably benign Het
Or8k31-ps1 A T 2: 86,356,174 (GRCm39) S116T possibly damaging Het
Paip1 C T 13: 119,587,306 (GRCm39) T390I possibly damaging Het
Pax8 T C 2: 24,326,573 (GRCm39) Y263C probably benign Het
Pcdha11 T A 18: 37,138,904 (GRCm39) Y178N probably benign Het
Pcdhga11 C T 18: 37,890,183 (GRCm39) T397M possibly damaging Het
Pdlim5 G T 3: 141,964,946 (GRCm39) H428N probably damaging Het
Pigg G A 5: 108,486,485 (GRCm39) V713I probably benign Het
Rgs3 A G 4: 62,619,349 (GRCm39) D478G possibly damaging Het
Scgb2b11 C T 7: 31,909,883 (GRCm39) E68K probably damaging Het
Sema4b C A 7: 79,869,995 (GRCm39) Q428K probably benign Het
Semp2l2a A T 8: 13,887,995 (GRCm39) I32K probably benign Het
Serpine2 T C 1: 79,780,622 (GRCm39) T276A probably benign Het
Sgo2b G A 8: 64,393,108 (GRCm39) H110Y probably benign Het
Slc6a15 T A 10: 103,229,241 (GRCm39) probably null Het
Srfbp1 G A 18: 52,608,671 (GRCm39) V24I probably damaging Het
Stpg2 A T 3: 139,407,458 (GRCm39) N537Y probably damaging Het
Svep1 A T 4: 58,087,782 (GRCm39) S1766T probably benign Het
Tiam2 T A 17: 3,532,880 (GRCm39) M1K probably null Het
Tmem245 A T 4: 56,899,170 (GRCm39) I661K possibly damaging Het
Trim5 T C 7: 103,928,569 (GRCm39) H124R probably damaging Het
Trim67 T A 8: 125,547,024 (GRCm39) L478Q probably damaging Het
Triml2 A G 8: 43,646,357 (GRCm39) D282G probably damaging Het
Txndc11 T C 16: 10,905,793 (GRCm39) Y579C probably damaging Het
Ube3c T A 5: 29,824,629 (GRCm39) D551E probably damaging Het
Vmn1r194 T C 13: 22,428,767 (GRCm39) V128A not run Het
Vmn2r130 T A 17: 23,296,006 (GRCm39) D725E probably damaging Het
Vmn2r70 T G 7: 85,218,130 (GRCm39) N56T probably damaging Het
Wdr95 T C 5: 149,517,945 (GRCm39) V501A possibly damaging Het
Zc3h8 T C 2: 128,772,742 (GRCm39) T249A probably damaging Het
Zfp54 T C 17: 21,654,501 (GRCm39) C332R probably damaging Het
Other mutations in Slc12a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc12a7 APN 13 73,942,201 (GRCm39) missense possibly damaging 0.77
IGL01086:Slc12a7 APN 13 73,962,962 (GRCm39) missense probably damaging 1.00
IGL01344:Slc12a7 APN 13 73,940,856 (GRCm39) missense probably damaging 1.00
IGL01739:Slc12a7 APN 13 73,947,733 (GRCm39) missense probably benign 0.00
IGL02039:Slc12a7 APN 13 73,957,213 (GRCm39) critical splice donor site probably null
IGL02213:Slc12a7 APN 13 73,945,822 (GRCm39) critical splice donor site probably null
IGL02285:Slc12a7 APN 13 73,943,714 (GRCm39) unclassified probably benign
IGL02422:Slc12a7 APN 13 73,954,280 (GRCm39) missense probably benign 0.18
IGL02423:Slc12a7 APN 13 73,911,882 (GRCm39) utr 5 prime probably benign
IGL02596:Slc12a7 APN 13 73,933,242 (GRCm39) missense probably benign 0.01
IGL02794:Slc12a7 APN 13 73,957,206 (GRCm39) missense possibly damaging 0.68
IGL02813:Slc12a7 APN 13 73,961,795 (GRCm39) unclassified probably benign
IGL02868:Slc12a7 APN 13 73,954,507 (GRCm39) missense probably benign
R0828:Slc12a7 UTSW 13 73,936,771 (GRCm39) missense probably benign 0.03
R1440:Slc12a7 UTSW 13 73,949,127 (GRCm39) missense probably damaging 1.00
R1659:Slc12a7 UTSW 13 73,938,790 (GRCm39) missense probably damaging 1.00
R1669:Slc12a7 UTSW 13 73,943,232 (GRCm39) missense probably benign 0.00
R2111:Slc12a7 UTSW 13 73,933,274 (GRCm39) nonsense probably null
R3023:Slc12a7 UTSW 13 73,948,541 (GRCm39) missense probably benign 0.07
R3612:Slc12a7 UTSW 13 73,958,042 (GRCm39) missense probably benign 0.30
R4210:Slc12a7 UTSW 13 73,962,962 (GRCm39) missense probably damaging 1.00
R4353:Slc12a7 UTSW 13 73,938,853 (GRCm39) missense possibly damaging 0.63
R4761:Slc12a7 UTSW 13 73,961,708 (GRCm39) missense probably benign 0.06
R4801:Slc12a7 UTSW 13 73,912,011 (GRCm39) critical splice donor site probably null
R4802:Slc12a7 UTSW 13 73,912,011 (GRCm39) critical splice donor site probably null
R5002:Slc12a7 UTSW 13 73,911,896 (GRCm39) missense possibly damaging 0.66
R5128:Slc12a7 UTSW 13 73,953,552 (GRCm39) missense probably benign 0.03
R5594:Slc12a7 UTSW 13 73,933,258 (GRCm39) missense probably benign
R5760:Slc12a7 UTSW 13 73,961,741 (GRCm39) missense probably damaging 1.00
R5854:Slc12a7 UTSW 13 73,942,059 (GRCm39) missense probably benign 0.03
R6233:Slc12a7 UTSW 13 73,953,590 (GRCm39) missense possibly damaging 0.63
R6693:Slc12a7 UTSW 13 73,945,656 (GRCm39) missense probably benign 0.00
R6782:Slc12a7 UTSW 13 73,947,088 (GRCm39) missense probably damaging 0.99
R7169:Slc12a7 UTSW 13 73,932,679 (GRCm39) missense probably benign 0.30
R7225:Slc12a7 UTSW 13 73,912,081 (GRCm39) intron probably benign
R7458:Slc12a7 UTSW 13 73,933,188 (GRCm39) missense probably damaging 1.00
R7534:Slc12a7 UTSW 13 73,912,187 (GRCm39) intron probably benign
R7565:Slc12a7 UTSW 13 73,938,891 (GRCm39) missense possibly damaging 0.58
R7737:Slc12a7 UTSW 13 73,936,796 (GRCm39) missense probably benign 0.01
R7783:Slc12a7 UTSW 13 73,953,588 (GRCm39) missense probably benign 0.44
R7875:Slc12a7 UTSW 13 73,936,723 (GRCm39) missense possibly damaging 0.94
R8017:Slc12a7 UTSW 13 73,947,839 (GRCm39) missense probably damaging 1.00
R8019:Slc12a7 UTSW 13 73,947,839 (GRCm39) missense probably damaging 1.00
R8281:Slc12a7 UTSW 13 73,938,796 (GRCm39) missense probably damaging 1.00
R8342:Slc12a7 UTSW 13 73,933,281 (GRCm39) missense probably benign
R8747:Slc12a7 UTSW 13 73,933,241 (GRCm39) missense probably benign 0.30
R8920:Slc12a7 UTSW 13 73,946,568 (GRCm39) missense probably damaging 1.00
R9069:Slc12a7 UTSW 13 73,954,089 (GRCm39) intron probably benign
R9292:Slc12a7 UTSW 13 73,932,707 (GRCm39) missense possibly damaging 0.46
R9381:Slc12a7 UTSW 13 73,949,063 (GRCm39) missense probably benign 0.00
R9400:Slc12a7 UTSW 13 73,932,689 (GRCm39) missense probably benign 0.00
R9521:Slc12a7 UTSW 13 73,947,087 (GRCm39) missense probably benign 0.38
R9687:Slc12a7 UTSW 13 73,938,796 (GRCm39) missense probably damaging 1.00
X0023:Slc12a7 UTSW 13 73,936,727 (GRCm39) missense possibly damaging 0.94
X0028:Slc12a7 UTSW 13 73,946,660 (GRCm39) splice site probably null
X0065:Slc12a7 UTSW 13 73,949,064 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATGGGACCATGCCTACTTAG -3'
(R):5'- GGGACATTTCTGCAGGAACTC -3'

Sequencing Primer
(F):5'- ATGCCTACTTAGCTTGTGACAG -3'
(R):5'- CATTTCTGCAGGAACTCAGGCAAG -3'
Posted On 2019-11-12