Incidental Mutation 'R0238:Pa2g4'
Institutional Source Beutler Lab
Gene Symbol Pa2g4
Ensembl Gene ENSMUSG00000025364
Gene Nameproliferation-associated 2G4
SynonymsPlfap, Ebp1
MMRRC Submission 038476-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.664) question?
Stock #R0238 (G1)
Quality Score159
Status Validated
Chromosomal Location128557766-128565987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128563642 bp
Amino Acid Change Lysine to Arginine at position 51 (K51R)
Ref Sequence ENSEMBL: ENSMUSP00000114434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026425] [ENSMUST00000082059] [ENSMUST00000131728]
Predicted Effect probably benign
Transcript: ENSMUST00000026425
AA Change: K51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026425
Gene: ENSMUSG00000025364
AA Change: K51R

Pfam:Peptidase_M24 19 293 2.1e-27 PFAM
low complexity region 359 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082059
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166

signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131728
AA Change: K51R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114434
Gene: ENSMUSG00000025364
AA Change: K51R

Pfam:Peptidase_M24 19 232 1.2e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197964
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is involved in growth regulation. This protein is present in pre-ribosomal ribonucleoprotein complexes and may be involved in ribosome assembly and the regulation of intermediate and late steps of rRNA processing. This protein can interact with the cytoplasmic domain of the ErbB3 receptor and may contribute to transducing growth regulatory signals. This protein is also a transcriptional co-repressor of androgen receptor-regulated genes and other cell cycle regulatory genes through its interactions with histone deacetylases. This protein has been implicated in growth inhibition and the induction of differentiation of human cancer cells. Six pseudogenes, located on chromosomes 3, 6, 9, 18, 20 and X, have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased body size and weight during early adulthood and produce smaller than normal litters. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T G 2: 156,550,973 V94G probably benign Het
Acp5 A T 9: 22,129,922 S70T possibly damaging Het
Adcy1 C G 11: 7,139,162 N525K possibly damaging Het
Adra1d C A 2: 131,546,214 V474F probably benign Het
AI464131 A T 4: 41,498,912 N239K probably benign Het
Aknad1 A G 3: 108,781,239 M628V probably benign Het
Alg8 A T 7: 97,383,684 probably null Het
Cacna1d A G 14: 30,123,496 V572A probably benign Het
Ccdc158 A C 5: 92,662,118 M177R probably benign Het
Ccdc191 A T 16: 43,947,496 R678* probably null Het
Cdkn2d C A 9: 21,290,992 probably benign Het
Cdx2 G T 5: 147,303,287 T193K probably damaging Het
Cfap44 T A 16: 44,422,318 M695K probably benign Het
Cfap70 A C 14: 20,448,605 S5A probably benign Het
Chd9 T C 8: 90,932,828 S139P probably damaging Het
Chmp7 A G 14: 69,720,997 V241A probably damaging Het
Cnga1 A G 5: 72,605,031 I380T probably damaging Het
Col4a1 C T 8: 11,218,780 probably benign Het
Cts6 T A 13: 61,201,819 E53D probably damaging Het
Cul2 A G 18: 3,414,115 probably benign Het
Dclk3 A T 9: 111,482,628 N646I probably damaging Het
Dnhd1 A G 7: 105,721,531 S4673G probably benign Het
Dock4 G T 12: 40,737,540 S818I probably damaging Het
Dysf C T 6: 84,064,479 Q156* probably null Het
Espnl T C 1: 91,322,287 V52A probably damaging Het
Fam163b T C 2: 27,112,634 N117S probably damaging Het
Fam89a A G 8: 124,741,232 Y114H probably damaging Het
Flcn T C 11: 59,801,076 N249S probably benign Het
Gnai1 A G 5: 18,273,550 S206P probably damaging Het
Hal T C 10: 93,503,482 S478P possibly damaging Het
Haus3 G A 5: 34,166,256 P337S possibly damaging Het
Hectd1 T A 12: 51,769,318 M1324L possibly damaging Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Hpn G T 7: 31,099,390 probably benign Het
Hspa9 A T 18: 34,946,646 Y243* probably null Het
Htr3a T C 9: 48,906,386 T96A probably benign Het
Ift140 C A 17: 25,045,523 C557* probably null Het
Il4ra T C 7: 125,575,199 probably benign Het
Ipo9 A G 1: 135,404,336 probably benign Het
Jph3 A G 8: 121,753,720 Q379R possibly damaging Het
Kcnb1 A G 2: 167,104,969 V653A probably benign Het
Kif14 A G 1: 136,527,393 E1551G probably damaging Het
Krt17 G A 11: 100,260,878 R30* probably null Het
Lamb3 A T 1: 193,321,053 D100V probably damaging Het
Lrmp G A 6: 145,171,978 probably benign Het
Map2 A G 1: 66,416,106 D1385G probably damaging Het
Map3k21 A G 8: 125,944,970 D999G possibly damaging Het
Marf1 T C 16: 14,151,283 I109V probably benign Het
Mcam T G 9: 44,140,205 probably null Het
Med18 T C 4: 132,460,026 H99R probably damaging Het
Mettl25 C T 10: 105,826,525 V195I probably damaging Het
Micu2 G A 14: 57,917,378 probably benign Het
Mpl A G 4: 118,456,863 probably benign Het
Myh8 A G 11: 67,301,692 T1466A probably benign Het
Myo1e A T 9: 70,342,126 I503F possibly damaging Het
Myo3b T A 2: 70,105,425 C61S probably benign Het
Nbn T C 4: 15,986,672 probably benign Het
Ndufa4 C T 6: 11,906,024 V10I probably benign Het
Nf1 A T 11: 79,418,574 K438M possibly damaging Het
Nlrp9c A G 7: 26,378,012 S727P possibly damaging Het
Nmbr C T 10: 14,770,395 Q338* probably null Het
Nt5e A G 9: 88,367,332 S440G possibly damaging Het
Nubp2 T C 17: 24,884,471 E144G probably damaging Het
Olfr1126 T C 2: 87,458,037 F291L probably benign Het
Olfr593 G A 7: 103,212,726 V289M possibly damaging Het
Olfr694 A G 7: 106,689,255 Y159H probably benign Het
Otogl T A 10: 107,806,696 N1291I probably damaging Het
Pah C T 10: 87,567,281 P173S possibly damaging Het
Pcdhb12 A G 18: 37,436,727 I309V probably benign Het
Pck1 T G 2: 173,157,068 I373S possibly damaging Het
Pga5 A G 19: 10,669,453 Y305H probably damaging Het
Plxnd1 G T 6: 115,968,793 D906E probably benign Het
Ppfia4 T C 1: 134,329,189 E98G possibly damaging Het
Pzp C T 6: 128,489,156 probably benign Het
Rab39 G A 9: 53,706,030 T29I probably damaging Het
Raet1e C A 10: 22,180,862 H112Q possibly damaging Het
Rars2 T C 4: 34,645,838 Y252H probably damaging Het
Rars2 A C 4: 34,656,030 Q421P probably benign Het
Rasa2 A T 9: 96,568,407 D479E probably damaging Het
Rbl2 A T 8: 91,106,507 T689S probably damaging Het
Rims4 C T 2: 163,864,025 V230M probably benign Het
Scgb1b27 G A 7: 34,021,952 probably benign Het
Sec31b G A 19: 44,525,469 probably benign Het
Six3 G A 17: 85,621,390 G51R probably damaging Het
Skp2 A C 15: 9,127,884 probably null Het
Slc35f4 A T 14: 49,304,256 I347N possibly damaging Het
Slc4a2 A T 5: 24,436,274 probably null Het
Slc52a3 T C 2: 152,008,156 *461Q probably null Het
Slc6a1 G A 6: 114,302,800 V142I probably benign Het
Susd5 A G 9: 114,096,909 *620W probably null Het
Timm21 T C 18: 84,947,666 N239S probably damaging Het
Tmem131 T C 1: 36,828,050 probably benign Het
Tmem63c T C 12: 87,075,639 W404R probably damaging Het
Tnrc6b A G 15: 80,887,864 D1118G probably damaging Het
Traf2 G C 2: 25,537,126 A71G possibly damaging Het
Trim54 A G 5: 31,134,119 M195V probably benign Het
Trip11 C T 12: 101,884,728 E741K probably damaging Het
Trp73 AGCTGCTGCTGCTGCTGCTG AGCTGCTGCTGCTGCTG 4: 154,062,524 probably benign Het
Trpm5 G T 7: 143,082,958 T414N probably damaging Het
Vps51 G T 19: 6,071,437 S185* probably null Het
Zfp329 G T 7: 12,810,829 T256K probably damaging Het
Zfp729b A G 13: 67,591,903 Y748H probably damaging Het
Zfp777 T C 6: 48,024,969 E773G probably damaging Het
Zfp866 T C 8: 69,766,715 Y53C probably damaging Het
Other mutations in Pa2g4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03165:Pa2g4 APN 10 128559060 critical splice donor site probably null
IGL03198:Pa2g4 APN 10 128565778 missense probably damaging 1.00
IGL03297:Pa2g4 APN 10 128563236 missense probably damaging 1.00
R0238:Pa2g4 UTSW 10 128563642 missense probably benign
R1326:Pa2g4 UTSW 10 128559273 missense probably benign 0.06
R3620:Pa2g4 UTSW 10 128563595 missense probably damaging 1.00
R4820:Pa2g4 UTSW 10 128559330 missense probably damaging 1.00
R5680:Pa2g4 UTSW 10 128559457 missense probably benign 0.37
R7069:Pa2g4 UTSW 10 128560690 missense probably benign 0.06
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tggggagacagaggcag -3'
Posted On2013-07-11