Incidental Mutation 'R7660:Farp1'
ID591532
Institutional Source Beutler Lab
Gene Symbol Farp1
Ensembl Gene ENSMUSG00000025555
Gene NameFERM, RhoGEF (Arhgef) and pleckstrin domain protein 1 (chondrocyte-derived)
SynonymsCdep
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7660 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location121035200-121283744 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 121276922 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 888 (A888T)
Ref Sequence ENSEMBL: ENSMUSP00000026635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026635]
Predicted Effect probably benign
Transcript: ENSMUST00000026635
AA Change: A888T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026635
Gene: ENSMUSG00000025555
AA Change: A888T

DomainStartEndE-ValueType
B41 36 230 3.27e-68 SMART
FERM_C 234 324 3.87e-32 SMART
FA 328 374 6.07e-16 SMART
RhoGEF 546 732 2.07e-47 SMART
PH 763 861 1.05e-16 SMART
PH 936 1034 1.55e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a FERM (4.2, exrin, radixin, moesin) domain, a Dbl homology domain, and two pleckstrin homology domains. These domains are found in guanine nucleotide exchange factors and proteins that link the cytoskeleton to the cell membrane. The encoded protein functions in neurons to promote dendritic growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427I04Rik A T 4: 123,860,719 H142L possibly damaging Het
Abca13 A G 11: 9,290,678 E847G probably benign Het
Abca9 T A 11: 110,115,452 T1276S probably benign Het
Abcb11 C T 2: 69,287,594 probably null Het
AF366264 A T 8: 13,837,995 I32K probably benign Het
Alpk1 G C 3: 127,680,967 H462Q probably damaging Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atm C T 9: 53,445,507 V2815M probably benign Het
Braf T C 6: 39,623,641 I681V possibly damaging Het
Casc3 C G 11: 98,809,873 R4G unknown Het
Crybg1 T C 10: 43,998,835 D759G probably damaging Het
Csrp2 A G 10: 110,937,763 N103S probably benign Het
Faf1 A T 4: 109,861,837 H380L probably damaging Het
Fat4 A T 3: 38,981,160 Q2987L probably benign Het
Fkbp15 T A 4: 62,314,341 T665S probably benign Het
Gigyf1 T C 5: 137,520,969 S343P probably benign Het
Glrx3 A G 7: 137,459,225 Y196C probably damaging Het
Gm3278 T G 14: 4,893,349 L66R probably damaging Het
Gm8298 A G 3: 59,865,268 I64M probably benign Het
Ick G C 9: 78,167,620 V586L probably benign Het
Ifi205 A G 1: 174,028,248 V72A probably benign Het
Ift140 T G 17: 25,051,824 L708R probably damaging Het
Ints13 A T 6: 146,557,338 L328M probably benign Het
Itfg2 A G 6: 128,424,746 I23T probably damaging Het
Ldha C T 7: 46,850,257 P100S unknown Het
Lmtk2 T A 5: 144,148,340 L210H probably damaging Het
Lrrc4 T A 6: 28,829,817 I600L probably benign Het
Map2 C A 1: 66,414,377 P809T probably damaging Het
Matn2 A G 15: 34,402,946 K439R probably benign Het
Matn2 T A 15: 34,423,728 C577* probably null Het
Mep1a C T 17: 43,478,977 G494S probably benign Het
Mtmr4 T C 11: 87,604,580 F488L probably damaging Het
Mtus1 G T 8: 41,016,211 T8K probably benign Het
Mug1 C A 6: 121,861,220 H470N possibly damaging Het
Mybpc1 T C 10: 88,548,854 T523A possibly damaging Het
Ncoa3 C T 2: 166,069,321 P1334S probably benign Het
Neb T G 2: 52,249,439 M119L Het
Nox4 T C 7: 87,370,022 Y408H probably damaging Het
Nxpe3 C T 16: 55,844,327 R510Q probably damaging Het
Olfr1077-ps1 A T 2: 86,525,830 S116T possibly damaging Het
Olfr1275 C T 2: 111,231,615 M59I probably damaging Het
Olfr48 T C 2: 89,844,443 T177A probably benign Het
Olfr484 A G 7: 108,124,834 V143A probably benign Het
Olfr807 C A 10: 129,754,563 E296* probably null Het
Olfr839-ps1 T C 9: 19,175,508 H56R probably benign Het
Paip1 C T 13: 119,450,770 T390I possibly damaging Het
Pax8 T C 2: 24,436,561 Y263C probably benign Het
Pcdha11 T A 18: 37,005,851 Y178N probably benign Het
Pcdhga11 C T 18: 37,757,130 T397M possibly damaging Het
Pdlim5 G T 3: 142,259,185 H428N probably damaging Het
Pigg G A 5: 108,338,619 V713I probably benign Het
Rgs3 A G 4: 62,701,112 D478G possibly damaging Het
Scgb2b11 C T 7: 32,210,458 E68K probably damaging Het
Sema4b C A 7: 80,220,247 Q428K probably benign Het
Serpine2 T C 1: 79,802,905 T276A probably benign Het
Sgo2b G A 8: 63,940,074 H110Y probably benign Het
Slc12a7 T C 13: 73,806,089 L833S probably benign Het
Slc6a15 T A 10: 103,393,380 probably null Het
Srfbp1 G A 18: 52,475,599 V24I probably damaging Het
Stpg2 A T 3: 139,701,697 N537Y probably damaging Het
Svep1 A T 4: 58,087,782 S1766T probably benign Het
Tiam2 T A 17: 3,482,605 M1K probably null Het
Tmem245 A T 4: 56,899,170 I661K possibly damaging Het
Trim5 T C 7: 104,279,362 H124R probably damaging Het
Trim67 T A 8: 124,820,285 L478Q probably damaging Het
Triml2 A G 8: 43,193,320 D282G probably damaging Het
Txndc11 T C 16: 11,087,929 Y579C probably damaging Het
Ube3c T A 5: 29,619,631 D551E probably damaging Het
Vmn1r194 T C 13: 22,244,597 V128A not run Het
Vmn2r70 T G 7: 85,568,922 N56T probably damaging Het
Vmn2r-ps130 T A 17: 23,077,032 D725E probably damaging Het
Wdr95 T C 5: 149,594,480 V501A possibly damaging Het
Zc3h8 T C 2: 128,930,822 T249A probably damaging Het
Zfp54 T C 17: 21,434,239 C332R probably damaging Het
Other mutations in Farp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Farp1 APN 14 121237149 missense probably damaging 1.00
IGL01017:Farp1 APN 14 121272774 missense possibly damaging 0.64
IGL02309:Farp1 APN 14 121243516 missense probably benign
IGL02376:Farp1 APN 14 121272856 missense probably damaging 0.98
IGL03018:Farp1 APN 14 121102169 missense probably benign
IGL03400:Farp1 APN 14 121207321 missense probably damaging 1.00
R0034:Farp1 UTSW 14 121255429 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0046:Farp1 UTSW 14 121255513 missense probably benign 0.00
R0219:Farp1 UTSW 14 121243600 missense possibly damaging 0.88
R0359:Farp1 UTSW 14 121255396 splice site probably benign
R0616:Farp1 UTSW 14 121277022 missense probably damaging 1.00
R0653:Farp1 UTSW 14 121233846 critical splice donor site probably null
R0710:Farp1 UTSW 14 121237143 missense probably damaging 1.00
R1391:Farp1 UTSW 14 121257966 nonsense probably null
R1791:Farp1 UTSW 14 121256745 missense probably damaging 1.00
R1920:Farp1 UTSW 14 121255496 missense probably benign 0.16
R1953:Farp1 UTSW 14 121255482 missense probably benign
R1958:Farp1 UTSW 14 121219375 critical splice acceptor site probably null
R2891:Farp1 UTSW 14 121256736 missense probably damaging 1.00
R3121:Farp1 UTSW 14 121222726 splice site probably benign
R4005:Farp1 UTSW 14 121276397 missense probably damaging 0.99
R4257:Farp1 UTSW 14 121255479 missense probably benign 0.00
R4559:Farp1 UTSW 14 121272801 missense probably damaging 1.00
R4654:Farp1 UTSW 14 121276304 missense possibly damaging 0.50
R4739:Farp1 UTSW 14 121238787 missense probably damaging 1.00
R4831:Farp1 UTSW 14 121277057 missense probably damaging 1.00
R4988:Farp1 UTSW 14 121275607 missense probably damaging 1.00
R5379:Farp1 UTSW 14 121256757 missense possibly damaging 0.88
R5463:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5466:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5467:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5511:Farp1 UTSW 14 121237172 missense probably damaging 0.98
R5520:Farp1 UTSW 14 121235077 missense probably damaging 1.00
R5635:Farp1 UTSW 14 121276304 missense possibly damaging 0.96
R5639:Farp1 UTSW 14 121275382 missense probably damaging 1.00
R5954:Farp1 UTSW 14 121222667 missense probably damaging 0.99
R6765:Farp1 UTSW 14 121222654 missense probably benign 0.00
R7469:Farp1 UTSW 14 121275421 missense probably damaging 1.00
R7549:Farp1 UTSW 14 121235177 missense possibly damaging 0.89
R7752:Farp1 UTSW 14 121257947 missense probably damaging 1.00
R7788:Farp1 UTSW 14 121276253 missense probably benign 0.12
R7911:Farp1 UTSW 14 121242406 missense probably damaging 1.00
R8013:Farp1 UTSW 14 121242401 missense probably damaging 1.00
R8078:Farp1 UTSW 14 121276300 missense probably benign 0.04
R8113:Farp1 UTSW 14 121275596 missense probably benign 0.35
R8116:Farp1 UTSW 14 121233820 missense probably damaging 1.00
R8716:Farp1 UTSW 14 121242443 missense probably benign
RF024:Farp1 UTSW 14 121237148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGTATCTACAGACAGGAAG -3'
(R):5'- TGAAAGCTAACTCAGGCCCC -3'

Sequencing Primer
(F):5'- TCTACAGACAGGAAGGATTCTCAGC -3'
(R):5'- AAGCTAACTCAGGCCCCGTTTC -3'
Posted On2019-11-12